Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU037311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Adam17

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00

Spedizione prevista il17 aprile 2025

Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00

Spedizione prevista il17 aprile 2025

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGAGCCACTTTGGAGGTTTGTCAATGATACTAAAGATAAACGAATGCTGGTGTATAAGTCTGAAGATATCAAGGATTTTTCACGTTTGCAGTCTCCAAAAGTATGTGGTTATTTAAATGCAGATAGTGAAGAGCTGCTTCCAAAAGGGCTCATAGACAGAGAGCCATCTGAAGAGTTTGTTCGTCGAGTGAAGAGACGAGCTGAACCTAACCCCTTGAAGAATACTTGTAAATTACTGGTGGTAGCAGATCATCGATTTTATAAATACATGGGCCGTGGCGAAGAGAGCACCACTACAAATTACTTAATAGAGCTAATTGACCGAGTTGATGACATATACCGGAACACGTCGTGGGATAATGCAGGGTTTAAAGGTTATGGAGTGCAGATAGAGCAGATTCGAATTCTCAAGTCTCCACAAGAGGTAAAACCTGGTGAAAGACACTTCAATATGGCAAAAAGTTTCCCAAACGAAGAGAAGGATGCTTGGGATGTG

N° accesso Ensembl | topo

ENSMUSG00000052593

N° accesso NCBI

NM_009615

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... ADAM17(11491) , Adam17(11491)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
VYS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Dong Fan et al.
Circulation. Heart failure, 8(5), 970-979 (2015-07-03)
A disintegrin and metalloproteinase 17 (ADAM17) is a membrane-bound enzyme that mediates shedding of many membrane-bound molecules, thereby regulating multiple cellular responses. We investigated the role of cardiomyocyte ADAM17 in myocardial infarction (MI). Cardiomyocyte-specific ADAM17 knockdown mice (ADAM17(flox/flox)/α-MHC-Cre; f/f/Cre) and
Qin Xu et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(8), 7575-7586 (2014-05-06)
Metalloproteinase activities of a disintegrin and metalloproteinase 17 (ADAM17), amphiregulin (AREG), extracellular matrix metalloproteinase inducer (EMMPRIN), and matrix metalloproteinases (MMPs) are involved in tumor biology. In patients with uterine cervical carcinoma, the expression and prognostic significance of ADAM17 remain to
Yang Wu et al.
FEBS letters, 588(12), 2063-2069 (2014-05-13)
As a cleavage enzyme of precursor TNF-α, the high expression level of ADAM17 in endothelial cells is an important factor in atherosclerosis. In this study, we demonstrate that ADAM17 is the target of miR-152. We found that miR-152 could reduce
Sarah Louise Dombernowsky et al.
Nature communications, 6, 7518-7518 (2015-06-26)
The metalloproteinase ADAM17 activates ErbB signalling by releasing ligands from the cell surface, a key step underlying epithelial development, growth and tumour progression. However, mechanisms acutely controlling ADAM17 cell-surface availability to modulate the extent of ErbB ligand release are poorly

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.