Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU033181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Btk

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTTGAAGGAGCTTGGGACTGGACAATTCGGTGTCGTGAAATATGGGAAGTGGAGGGGCCAATATGATGTGGCCATCAAGATGATCAGAGAAGGTTCCATGTCGGAGGATGAATTCATTGAAGAAGCCAAAGTCATGATGAATCTTTCCCATGAGAAGCTGGTGCAGTTGTATGGCGTCTGCACCAAACAACGCCCCATCTTCATCATCACCGAGTACATGGCTAATGGCTGCCTCTTGAACTACCTGAGGGAGATGCGGCACCGCTTCCAGACACAGCAGCTGCTTGAGATGTGCAAAGATGTCTGTGAAGCAATGGAATACTTGGAGTCGAAGCAGTTCCTTCACAGAGACCTGGCAGCTCGAAACTGTTTGGTAAACGATCAAGGAGTTGTGAAAGTATCTGACTTTGGCCTGTCTAGGTATGTCCTTGATGATGAGTACACCAGCTCTGTAGGCTCCAAGTTTCCAGTTCGGTGGT

N° accesso Ensembl | topo

ENSMUSG00000031264

N° accesso NCBI

NM_013482

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... BTK(12229) , Btk(12229)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Agnieszka Krupa et al.
American journal of physiology. Lung cellular and molecular physiology, 307(6), L435-L448 (2014-08-03)
Previous observations made by our laboratory indicate that Bruton's tyrosine kinase (Btk) may play an important role in the pathophysiology of local inflammation in acute lung injury (ALI)/acute respiratory distress syndrome (ARDS). We have shown that there is cross talk
Genevra Pillinger et al.
Scientific reports, 5, 12949-12949 (2015-08-22)
Approximately 20% of patients with acute myeloid leukaemia (AML) have a mutation in FMS-like-tyrosine-kinase-3 (FLT3). FLT3 is a trans-membrane receptor with a tyrosine kinase domain which, when activated, initiates a cascade of phosphorylated proteins including the SRC family of kinases.
Angela Marina Montalbano et al.
European journal of pharmacology, 736, 35-43 (2014-05-07)
Cigarette smoke extract (CSE) affects the expression of Choline Acetyl-Transferase (ChAT), muscarinic acetylcholine receptors, and mucin production in bronchial epithelial cells. Mucin 5AC (MUC5AC), muscarinic acetylcholine receptor M3, ChAT expression, acetylcholine levels and acetylcholine binding were measured in a human
Neeraj Maurya et al.
Journal of immunology (Baltimore, Md. : 1950), 193(7), 3417-3425 (2014-08-31)
The receptor T cell Ig and mucin protein-3 (TIM-3) has emerged as an important regulator of innate immune responses. However, whether TIM-3-induced signaling promotes or inhibits the activation and maturation of dendritic cells (DCs) still remains uncertain. In addition, the
Panyu Zhou et al.
Cell biochemistry and biophysics, 70(2), 1265-1275 (2014-06-08)
Sepsis is a common and critical complication in surgical patients that often leads to multiple organ failure syndrome (MOFS), including acute lung injury (ALI) and acute respiratory distress syndrome (ARDS). Despite intensive supportive care and treatment modalities, the mortality of
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.