Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU031541

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pmaip1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AACTCCGGAGGATTGGAGACAAAGTGAATTTACGGCAGAAACTTCTGAATTTGATTTCCAAGCTCTTCAATTTAGTAACCTGAGTTCTTCCAAAGCTTTTGCAAGAAGGGACCTCCCAGGAAGGAAGTTCCGCCGGTTGATGGAAATGCCTGGTATTGGATGGATTGTGATGTGATGAGAGAAACGCTCGCTTGCTTTTGGTTCCCTGAGCAGGGATGATGAAGGAGATAGGAATGAGTTTCTTTCGGAAAGTTTTCAGAAATCGTTCTTTGAGCTGTGATAACGTGAAACCACACTTGTTTTTACTTTTATTATTATTTTTTTGAAGAGTCGTGGAGCTAGGGAAGTAACTAGTAATAATCTATCTTTTTAGAGTTGTTCTGGTTGTTTTTGCCAAAGGTTGTTGTCAAGAATAATAGACGGGGTATGGCTAGTGGTTACATTGTATGGGGGCAGTCGTTTGGGATTGCTTT

N° accesso Ensembl | topo

ENSMUSG00000024521

N° accesso NCBI

NM_021451

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... PMAIP1(58801) , Pmaip1(58801)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wei Qian et al.
Oncotarget, 5(12), 4180-4194 (2014-06-24)
Overcoming platinum drug resistance represents a major clinical challenge in cancer treatment. We discovered a novel drug combination using cisplatin and a class of thioquinazolinone derivatives including mdivi-1 (mitochondrial division inhibitor-1), that induces synergistic apoptosis in platinum resistant tumor cells
Georg Karpel-Massler et al.
Oncotarget, 6(34), 36456-36471 (2015-10-17)
Glioblastoma is the most frequent primary brain tumor in adults. Current therapeutic options are sparse and the prognosis of patients suffering from this disease is grim. Abundance in intratumoral heterogeneity among different deregulated signaling pathways is a hallmark of glioblastoma
Xiao-Lan Li et al.
Oncotarget, 6(34), 36689-36699 (2015-10-10)
PRIMA-1met (APR-246) is a methylated derivative and structural analog of PRIMA-1 (p53 re-activation and induction of massive apoptosis). PRIMA-1met has been reported to restore both the wild type (wt) structure and function of mutant p53. Here, we show that PRIMA-1met
Haichao Zhang et al.
Molecular cancer, 14, 126-126 (2015-07-03)
Defects in programmed cell death, or apoptosis, are a hallmark of cancer. The anti-apoptotic B-cell lymphoma 2 (BCL-2) family proteins, including BCL-2, BCL-X(L), and MCL-1 have been characterized as key survival factors in multiple cancer types. Because cancer types with
Florian Engert et al.
Molecular cancer therapeutics, 14(12), 2818-2830 (2015-10-07)
Ewing sarcoma has recently been reported to be sensitive to poly(ADP)-ribose polymerase (PARP) inhibitors. Searching for synergistic drug combinations, we tested several PARP inhibitors (talazoparib, niraparib, olaparib, veliparib) together with chemotherapeutics. Here, we report that PARP inhibitors synergize with temozolomide

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.