Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU029651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wnt10a

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCTCTGGGTCTCAAGAATGGTTGTCCTCTTGGTGCCTGGCTTCTGCCGCTAGCGGATCTGAGCCAGGCAGCAAGCAGCAGCCTTGGCTCCTGAGAGAGGTGGTTGGCTCTTACAGCCCCGAGGGTCTACAATCACCAGACAGTCCAGATCTGATTGACATTCCTCCGCTCACCTCTGTAGGTTCCCCTCTTTCTGTTCCTAGCTCAGACAGCTGGGGGTGATAGTGGAGACTGTTCCACACCCTAGGACAGGTCACCAAAGCAGCCCAGCCTGGCATGCCTACCTCCTGTCATCTCTTCTTCCCTTCCCCAGGAGTGATAGGCAATGCACTGAAGCTGATGGGCACCGGGGAAGAAAACTAAAAGGCAGAAATGGCCGTCATCGGGCTGAAGTGACTCTAAGGGCTCCAGACCTCTGCTCCTGTCTTTCACTTAACAGATATTTATTTTTGCGCTCTCTTTGAGACA

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ren-Jun Hsu et al.
PloS one, 7(10), e47649-e47649 (2012-10-25)
Renal cell carcinoma (RCC) is a malignancy with poor prognosis. WNT/β-catenin signaling dysregulation, especially β-catenin overactivation and WNT antagonist silencing, is associated with RCC carcinogenesis and progression. However, the role of WNT ligands in RCC has not yet been determined.
Fujun Yu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 39(6), 2409-2420 (2016-11-11)
Wnt/β-catenin pathway is involved in liver fibrosis and microRNAs (miRNAs) are considered as key regulators of the activation of hepatic stellate cells (HSCs). A recent study showed the protective role of miR-378a-3p against cardiac fibrosis. However, whether miR-378a-3p suppresses Wnt/β-catenin
Jia Jing et al.
Adipocyte, 9(1), 401-414 (2020-07-24)
We discovered a unique expression pattern of two histone methyltransferases Suv39h1 and Suv39h2 during 3T3-L1 adipogenesis, both of which preferentially catalyse the formation of H3K9 dimethylation (H3K9me2) and further H3K9 trimethylation (H3K9me3), a transcriptional repressive mark. The expression of Suv39h1

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.