Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU026991

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mdm2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGTTTGGAGTCCCGAGTTTCTCTGTGAAGGAGCACAGGAAAATATATGCAATGATCTACAGAAATTTAGTGGCTGTAAGTCAGCAAGACTCTGGCACATCGCTGAGTGAGAGCAGACGTCAGCCTGAAGGTGGGAGTGATCTGAAGGATCCTTTGCAAGCGCCACCAGAAGAGAAACCTTCATCTTCTGATTTAATTTCTAGACTGTCTACCTCATCTAGAAGGAGATCCATTAGTGAGACAGAAGAGAACACAGATGAGCTACCTGGGGAGCGGCACCGGAAGCGCCGCAGGTCCCTGTCCTTTGATCCGAGCCTGGGTCTGTGTGAGCTGAGGGAGATGTGCAGCGGCGGCAGCAGCAGCAGTAGCAGCAGCAGCAGCGAGTCCACAGAGACGCCCTCGCATCAGGATCTTGACGATGGCGTAAGTGAGCATTCTGGTGATTGCCTGGATCAGGAT

N° accesso Ensembl | topo

ENSMUSG00000020184

N° accesso NCBI

NM_010786

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... MDM2(17246) , Mdm2(17246)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
TMU
CHU
WBU
QUT
OCT

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Shaneabbas Raza et al.
Molecular and cellular biochemistry, 410(1-2), 187-195 (2015-09-10)
Estrogen is synthesized from cholesterol and high cholesterol levels are suggested to be associated with increased risk of estrogen receptor(ER)-positive breast cancer. The cholesterol metabolite 27-hydroxycholesterol (27-OHC) was recently identified as a selective estrogen receptor modulator (SERM) and may therefore
Eva Slabáková et al.
Oncotarget, 6(34), 36156-36171 (2015-09-30)
Plasticity of cancer cells, manifested by transitions between epithelial and mesenchymal phenotypes, represents a challenging issue in the treatment of neoplasias. Both epithelial-mesenchymal transition (EMT) and mesenchymal-epithelial transition (MET) are implicated in the processes of metastasis formation and acquisition of
Hong Zhu et al.
Oncotarget, 6(5), 3254-3267 (2014-09-17)
Adriamycin, a widely used anthracycline antibiotic in multiple chemotherapy regimens, has been challenged by the cardiotoxicity leading to fatal congestive heart failure in the worst condition. The present study demonstrated that Dihydromyricetin, a natural product extracted from ampelopsis grossedentat, exerted
Jiang-Jiang Qin et al.
Oncotarget, 6(5), 2623-2640 (2015-03-05)
The MDM2 oncogene has been suggested as a molecular target for treating human cancers, including breast cancer. Most MDM2 inhibitors under development are targeting the MDM2-p53 binding, and have little or no effects on cancers without functional p53, such as
Seemana Bhattacharya et al.
The FEBS journal, 281(13), 3061-3078 (2014-05-16)
Tumor suppressor retinoblastoma-associated protein (Rb) is an important cell cycle regulator, arresting cells in early G1. It is commonly inactivated in cancers and its level is maintained during the cell cycle. Rb is regulated by various post-translational modifications such as
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.