Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU158661

Sigma-Aldrich

MISSION® esiRNA

targeting human NONO

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGAAATCTTCCTCCCGACATCACTGAGGAAGAAATGAGGAAACTATTTGAGAAATATGGAAAGGCAGGCGAAGTCTTCATTCATAAGGATAAAGGATTTGGCTTTATCCGCTTGGAAACCCGAACCCTAGCGGAGATTGCCAAAGTGGAGCTGGACAATATGCCACTCCGTGGAAAGCAGCTGCGTGTGCGCTTTGCCTGCCATAGTGCATCCCTTACAGTTCGAAACCTTCCTCAGTATGTGTCCAACGAACTGCTGGAAGAAGCCTTTTCTGTGTTTGGCCAGGTAGAGAGGGCTGTAGTCATTGTGGATGATCGAGGAAGGCCCTCAGGAAAAGGCATTGTTGAGTTCTCAGGGAAGCCAGCTGCTCGGAAAGCTCTGGACAGATGCAGTGAAGGCTCCTTCCTGCTAACCACATTTCCTCGTCCTG

N° accesso Ensembl | uomo

ENSG00000147140

N° accesso NCBI

NM_001145408

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... NONO(4841) , NONO(4841)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Rui Cheng et al.
Oncology reports, 39(6), 2575-2583 (2018-04-06)
Esophageal squamous cell carcinoma (ESCC) is one of the most common malignancies in China, and is associated with high morbidity and mortality. However, the molecular mechanisms that control ESCC tumorigenicity and metastasis remain unclear. Here, we report that the RNA
Taotao Han et al.
The Journal of clinical investigation, 130(7), 3901-3918 (2020-06-17)
Chronic infections can lead to carcinogenesis through inflammation-related mechanisms. Chronic infection of the human gastric mucosa with Helicobacter pylori is a well-known risk factor for gastric cancer. However, the mechanisms underlying H. pylori-induced gastric carcinogenesis are incompletely defined. We aimed
Lotte Victoria Winther Stagsted et al.
eLife, 10 (2021-01-22)
Circular RNAs (circRNAs) represent an abundant and conserved entity of non-coding RNAs; however, the principles of biogenesis are currently not fully understood. Here, we identify two factors, splicing factor proline/glutamine rich (SFPQ) and non-POU domain-containing octamer-binding protein (NONO), to be
Jarrod S Johnson et al.
Cell reports, 30(3), 914-931 (2020-01-23)
Transcriptional programming of the innate immune response is pivotal for host protection. However, the transcriptional mechanisms that link pathogen sensing with innate activation remain poorly understood. During HIV-1 infection, human dendritic cells (DCs) can detect the virus through an innate
Asma Chaoui et al.
Human molecular genetics, 24(17), 4933-4947 (2015-06-11)
SOX10 is a transcription factor with well-known functions in neural crest and oligodendrocyte development. Mutations in SOX10 were first associated with Waardenburg-Hirschsprung disease (WS4; deafness, pigmentation defects and intestinal aganglionosis). However, variable phenotypes that extend beyond the WS4 definition are

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.