Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU157231

Sigma-Aldrich

MISSION® esiRNA

targeting human NR4A1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACCTTCATGGACGGCTACACAGGAGAGTTTGACACCTTCCTCTACCAGCTGCCAGGAACAGTCCAGCCATGCTCCTCAGCCTCCTCCTCGGCCTCCTCCACATCCTCGTCCTCAGCCACCTCCCCTGCCTCTGCCTCCTTCAAGTTCGAGGACTTCCAGGTGTACGGCTGCTACCCCGGCCCCCTGAGCGGCCCAGTGGATGAGGCCCTGTCCTCCAGTGGCTCTGACTACTATGGCAGCCCCTGCTCGGCCCCGTCGCCCTCCACGCCCAGCTTCCAGCCGCCCCAGCTCTCTCCCTGGGATGGCTCCTTCGGCCACTTCTCGCCCAGCCAGACTTACGAAGGCCTGCGGGCATGGACAGAGCAGCTGCCCAAAGCCTCTGGGCCCCCACAGCCTCCAGCCTTCTTTTCCTTCA

N° accesso Ensembl | uomo

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Zeyu Shi et al.
Theranostics, 11(7), 3376-3391 (2021-02-05)
Background: Colorectal cancer (CRC) and the associated metastatic lesions are reported to be hypoxic. Hypoxia is a common feature in the tumor microenvironment and a potent stimulant of CRC. We have identified a regulatory role of Nur77 on Akt activation
Bin Huang et al.
Scientific reports, 8(1), 13895-13895 (2018-09-19)
Nur77 is a member of the NR4A subfamily of nuclear receptors and has been shown to regulate various biological processes such as apoptosis and inflammation. Here, we show that Nur77 ubiquitination is mediated by the tripartite motif 13 (Trim13), a
Hiroki Maruoka et al.
Scientific reports, 10(1), 6325-6325 (2020-04-15)
Forskolin promotes neuronal differentiation of PC12 cells via the PKA-CREB-dependent signaling pathway. Activation of PKA by forskolin phosphorylates CREB, which then binds to CRE sites in numerous gene promoters. However, it is unclear which gene contains the CRE sites responsible
Meihui Huang et al.
Journal of Cancer, 10(15), 3560-3570 (2019-07-12)
NR4A1 acts as an oncogene and plays an important role in colorectal cancer development and progression, but little is known about the regulatory mechanism of NR4A1 expression. MicroRNA (miRNA) is involved in the progression of various tumors, affecting proliferation, apoptosis
Xina Xie et al.
Clinical science (London, England : 1979), 129(12), 1151-1161 (2015-09-24)
Hypercholesterolaemia and inflammation are correlated with atherogenesis. Orphan nuclear receptor NR4A1, as a key regulator of inflammation, is closely associated with lipid levels in vivo. However, the mechanism by which lipids regulate NR4A1 expression remains unknown. We aimed to elucidate the

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.