Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU154301

Sigma-Aldrich

MISSION® esiRNA

targeting human PLD2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GATGAGTCTGCTCCCTCTGGCTCGATTTGCCGTTGCCTATTCTCCAGCCCGAGATGCAGGCAACAGAGAGATGCCCTCTCTACCCCGGGCAGGTCCTGAGGGCTCCACCAGACATGCAGCCAGCAAACAGAAATACCTGGAGAATTACCTCAACCGTCTCTTGACCATGTCTTTCTATCGCAACTACCATGCCATGACAGAGTTCCTGGAAGTCAGTCAGCTGTCCTTTATCCCGGACTTGGGCCGCAAAGGACTGGAGGGGATGATCCGGAAGCGCTCAGGTGGCCACCGTGTTCCTGGCCTCACCTGCTGTGGCCGAGACCAAGTTTGTTATCGCTGGTCCAAGAGGTGGCTGGTGGTGAAGGACTCCTTCCTGCTGTACATGTGCCTCGAGACAGGTGCCATCTCATTTGTTCAGCTCTTTGACCCTGG

N° accesso Ensembl | uomo

ENSG00000129219

N° accesso NCBI

NM_002663

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PLD2(5338) , PLD2(5338)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Chang Sup Lee et al.
BMB reports, 49(3), 191-196 (2016-01-29)
Vascular endothelial growth factor (VEGF) is a key mediator of angiogenesis and critical for normal embryonic development and repair of pathophysiological conditions in adults. Although phospholipase D (PLD) activity has been implicated in angiogenic processes, its role in VEGF signaling
Raja-Elie E Abdulnour et al.
Journal of leukocyte biology, 103(5), 919-932 (2018-02-14)
Phospholipase D (PLD) plays important roles in cellular responses to tissue injury that are critical to acute inflammatory diseases, such as the acute respiratory distress syndrome (ARDS). We investigated the expression of PLD isoforms and related phospholipid phosphatases in patients
Xiaoyong Wang et al.
Molecular medicine reports, 16(2), 1964-1972 (2017-06-29)
Aquaporin 3 (AQP3) and phospholipase D2 (PLD2) are abnormally expressed and/or localized in squamous cell carcinoma (SCC). AQP3 transports glycerol to PLD2 for the synthesis of lipid second messenger, which can mediate the effect of the AQP3/PLD2 signaling module in
Rochelle K Nelson et al.
Scientific reports, 7(1), 9112-9112 (2017-08-24)
The Phospholipase D (PLD) superfamily is linked to neurological disease, cancer, and fertility, and a recent report correlated a potential loss-of-function PLD2 polymorphism with hypotension. Surprisingly, PLD2 -/- mice exhibit elevated blood pressure accompanied by associated changes in cardiac performance

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.