Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU153581

Sigma-Aldrich

MISSION® esiRNA

targeting human TESC

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCTACCATTCGCAAGGAGAACTTCAACAATGTCCCGGACCTGGAGCTCAACCCCATCCGATCCAAAATTGTTCGTGCCTTCTTCGACAACAGGAACCTGCGCAAGGGACCCAGTGGCCTGGCTGATGAGATCAATTTCGAGGACTTCCTGACCATCATGTCCTACTTCCGGCCCATCGACACCACCATGGACGAGGAACAGGTGGAGCTGTCCCGGAAGGAGAAGCTGAGATTTCTGTTCCACATGTACGACTCGGACAGCGACGGCCGCATCACTCTGGAAGAATATCGAAATGTAAAGTGGTCGAGGAGCTGCTGTCGGGAAACCCTCACATCGAGAAGGAGTCCGCTCGCTCCATCGCCGACGGGGCCATGATGGAGGCGGCCAGCGTGTGCATGGGGCAGATGGAGCCTGATCAGGTGTACGAGGGGATCACCTTC

N° accesso Ensembl | uomo

ENSG00000088992

N° accesso NCBI

NM_017899

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... TESC(54997) , TESC(54997)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jieun Kang et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13843-13853 (2016-08-04)
We reported previously that tescalcin (TESC) levels were higher in tissue and serum from colorectal cancer (CRC) patients and suggested that TESC was a potential oncotarget in CRC. The aim of this study was to investigate the function of TESC
Ai-Jing Luo et al.
Experimental and molecular pathology, 107, 110-117 (2018-12-31)
Renal cell carcinoma (RCC) is the most common form of kidney cancer. Recent studies reported that Tescalcin was overexpressed in various tumor types. However, the status of Tescalcin protein expression in RCC and its biological function is uncertain. This study
Yun Hee Kang et al.
Oncotarget, 5(8), 2149-2160 (2014-05-09)
Tescalcin (TESC) is an EF-hand calcium binding protein that is differentially expressed in several tissues, however it is not reported that the expression and functional roles of TESC in colorectal cancer. Levels of messenger RNA (mRNA) and protein expression of

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.