Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU145931

Sigma-Aldrich

MISSION® esiRNA

targeting human MARVELD2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGTTGCTGGATTAGCTTGGATCACCACCATTATTATTCTGGTTCTTGGCATGTCCATGTATTACCGGACCATTCTTCTGGACTCTAATTGGTGGCCCCTAACTGAATTTGGAATTAACGTTGCCTTGTTTATTTTGTATATGGCCGCAGCCATAGTCTATGTGAATGATACCAACCGAGGTGGCCTCTGCTACTATCCGTTATTTAATACACCAGTGAATGCAGTGTTCTGCCGGGTAGAAGGAGGACAGATAGCTGCAATGATCTTCCTGTTTGTCACCATGATAGTTTATCTCATTAGTGCTTTGGTTTGCCTAAAGTTATGGAGGCATGAGGCAGCTCGGAGACATAGAGAATATATGGAACAACAGGAGATAAATGAGCCATCATTGTCATCGAAAAGGAAAATGTGTGAAATGGCC

N° accesso Ensembl | uomo

ENSG00000152939

N° accesso NCBI

NM_001038603

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MARVELD2(153562) , MARVELD2(153562)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Timothy Smyth et al.
Particle and fibre toxicology, 17(1), 52-52 (2020-10-17)
While exposure to diesel exhaust particles has been linked to aberrant immune responses in allergic diseases such as asthma, little attention has been paid to their effects on the airway epithelial barrier. In this study, we sought to determine the
Susanne M Krug
Annals of the New York Academy of Sciences, 1397(1), 219-230 (2017-06-13)
The tricellular tight junction (tTJ) is a potential weak point of the paracellular barrier. For solving the proportional contribution of the tTJ, ion conductances and macromolecule permeabilities were analyzed in cell lines of different leakiness. MDCK II, Caco-2, and HT-29/B6
Lawrence C S Tam et al.
Scientific reports, 7, 40717-40717 (2017-01-17)
The juxtacanalicular connective tissue of the trabecular meshwork together with inner wall endothelium of Schlemm's canal (SC) provide the bulk of resistance to aqueous outflow from the anterior chamber. Endothelial cells lining SC elaborate tight junctions (TJs), down-regulation of which
S M Krug et al.
Mucosal immunology, 11(2), 345-356 (2017-06-15)
In the two inflammatory bowel diseases, ulcerative colitis (UC) and Crohn's disease (CD), altered expression of tight junction (TJ) proteins leads to an impaired epithelial barrier including increased uptake of luminal antigens supporting the inflammation. Here, we focused on regulation
Paul S Cassidy et al.
Molecular therapy. Methods & clinical development, 20, 86-94 (2020-12-31)
Systemic or localized application of glucocorticoids (GCs) can lead to iatrogenic ocular hypertension, which is a leading cause of secondary open-angle glaucoma and visual impairment. Previous work has shown that dexamethasone increases zonula occludens-1 (ZO-1) protein expression in trabecular meshwork

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.