Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU144011

Sigma-Aldrich

MISSION® esiRNA

targeting human APEX1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGATGGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCCTTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCAATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGCCCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAATTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTACCGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGACCTC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Mengxia Li et al.
Nucleic acids research, 46(11), 5664-5677 (2018-05-12)
Base excision repair (BER) handles many forms of endogenous DNA damage, and apurinic/apyrimidinic endonuclease 1 (APE1) is central to this process. Deletion of both alleles of APE1 (a.k.a. Apex1) in mice leads to embryonic lethality, and deficiency in cells can
Shu-Ting Pan et al.
BMC cancer, 20(1), 634-634 (2020-07-10)
Drug resistance is a major cause of therapeutic failure that is often associated with elevated autophagy and apurinic/apyrimidinic endonuclease 1 (APE1) expression. Herein, we investigated the role of APE1 and autophagy in A549 cells treated with cisplatin. SILAC proteomics was
Aaron M Fleming et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(10), 2604-2609 (2017-02-02)
Reactive oxygen species (ROS) have emerged as important cellular-signaling agents for cellular survival. Herein, we demonstrate that ROS-mediated oxidation of DNA to yield 8-oxo-7,8-dihydroguanine (OG) in gene promoters is a signaling agent for gene activation. Enhanced gene expression occurs when
Hong-Beum Kim et al.
Annals of surgical treatment and research, 92(1), 15-22 (2017-01-17)
Biliary cancer is a highly malignant neoplasm with poor prognosis and most patients need to undergo palliative chemotherapy, however major clinical problem associated with the use of chemotherapy is chemoresistance. So far, we aimed at investigating clinical implications of apurinic/apyrimidinic
Nasrin Akhter et al.
The Journal of biological chemistry, 291(45), 23672-23680 (2016-09-18)
Apurinic/apyrimidinic endonuclease 1/redox factor-1 (Ape1/Ref-1) is a multifunctional protein possessing DNA repair, redox control, and transcriptional regulatory activities. Although Ape1/Ref-1 plays multiple roles in the immune system, its functions in helper T (Th) cell activation and differentiation are largely unknown.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.