Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU143641

Sigma-Aldrich

MISSION® esiRNA

targeting human FLT4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACACCTGGACCGAGTTTGTGGAGGGAAAGAATAAGACTGTGAGCAAGCTGGTGATCCAGAATGCCAACGTGTCTGCCATGTACAAGTGTGTGGTCTCCAACAAGGTGGGCCAGGATGAGCGGCTCATCTACTTCTATGTGACCACCATCCCCGACGGCTTCACCATCGAATCCAAGCCATCCGAGGAGCTACTAGAGGGCCAGCCGGTGCTCCTGAGCTGCCAAGCCGACAGCTACAAGTACGAGCATCTGCGCTGGTACCGCCTCAACCTGTCCACGCTGCACGATGCGCACGGGAACCCGCTTCTGCTCGACTGCAAGAACGTGCATCTGTTCGCCACCCCTCTGGCCGCCAGCCTGGAGGAGGTGGCACCTGGGGCGCGCCACGCCACGCTCAGCCTGAGTATCCCCCGCGTCGCGCCCGAGCACGAGGGCCACTATGTGTGCGAAGTGCAAGACCGGCGCAGCCATGACAAGCACTGCCACAAGAA

N° accesso Ensembl | uomo

ENSG00000037280

N° accesso NCBI

NM_002020

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FLT4(2324) , FLT4(2324)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Joo-Hee Park et al.
PloS one, 9(9), e109055-e109055 (2014-10-01)
MAZ51 is an indolinone-based molecule originally synthesized as a selective inhibitor of vascular endothelial growth factor receptor (VEGFR)-3 tyrosine kinase. This study shows that exposure of two glioma cell lines, rat C6 and human U251MG, to MAZ51 caused dramatic shape
Sungwoon Lee et al.
The Journal of clinical investigation, 127(2), 457-471 (2016-12-20)
Controlled angiogenesis and lymphangiogenesis are essential for tissue development, function, and repair. However, aberrant neovascularization is an essential pathogenic mechanism in many human diseases, including diseases involving tumor growth and survival. Here, we have demonstrated that mice deficient in C-type
Yan Zhang et al.
Nature communications, 9(1), 1296-1296 (2018-04-05)
Incomplete delivery to the target cells is an obstacle for successful gene therapy approaches. Here we show unexpected effects of incomplete targeting, by demonstrating how heterogeneous inhibition of a growth promoting signaling pathway promotes tissue hyperplasia. We studied the function
Raj Kumar et al.
Cell death & disease, 11(5), 325-325 (2020-05-10)
Pathological retinal neovascularization is the most common cause of vision loss. PKCθ has been shown to play a role in type 2 diabetes, which is linked to retinal neovascularization. Based on these clues, we have studied the role of PKCθ

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.