Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU142811

Sigma-Aldrich

MISSION® esiRNA

targeting human ROR2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGTGAAGTGGAGGTTCTGGATCCGAACGACCCTTTAGGACCCCTTGATGGGCAGGACGGCCCGATTCCAACTCTGAAAGGTTACTTTCTGAATTTTCTGGAGCCAGTAAACAATATCACCATTGTCCAAGGCCAGACGGCAATTCTGCACTGCAAGGTGGCAGGAAACCCACCCCCTAACGTGCGGTGGCTAAAGAATGATGCCCCGGTGGTGCAGGAGCCGCGGCGGATCATCATCCGGAAGACAGAATATGGTTCACGACTGCGAATCCAGGACCTGGACACGACAGACACTGGCTACTACCAGTGCGTGGCCACCAACGGGATGAAGACCATTACCGCCACTGGCGTCCTGTTTGTGCGGCTGGGTCCAACGCACAGCCCAAATCATAACTTTCAGGATGATTACCACGAGGATGGGT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Dongli Liu et al.
Scientific reports, 10(1), 13906-13906 (2020-08-19)
ROR1 and ROR2 are receptor tyrosine kinases with altered expression in a range of cancers. Silencing ROR1 or ROR2 in different tumour types has been shown to inhibit proliferation and decrease metastatic potential. The aim of this study was to
Juho Heliste et al.
BMC cardiovascular disorders, 18(1), 196-196 (2018-10-22)
Receptor tyrosine kinases (RTK) are potential targets for the treatment of ischemic heart disease. The human RTK family consists of 55 members, most of which have not yet been characterized for expression or activity in the ischemic heart. RTK gene
Fernanda Faião-Flores et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5686-5701 (2019-06-23)
The clinical use of MEK inhibitors in uveal melanoma is limited by the rapid acquisition of resistance. This study has used multiomics approaches and drug screens to identify the pan-HDAC inhibitor panobinostat as an effective strategy to limit MEK inhibitor
Claire Henry et al.
Oncotarget, 6(37), 40310-40326 (2015-10-31)
In recent years, the Wnt signalling pathway has been implicated in epithelial ovarian cancer and its members have potential as diagnostic, prognostic and therapeutic targets. Here we investigated the role of two Wnt receptor tyrosine kinases (RTKs), ROR1 and ROR2
Atsuko Ishizuya-Oka et al.
PloS one, 9(9), e107611-e107611 (2014-09-12)
Amphibian intestinal remodeling, where thyroid hormone (T3) induces some larval epithelial cells to become adult stem cells analogous to the mammalian intestinal ones, serves as a unique model for studying how the adult stem cells are formed. To clarify its

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.