Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU142651

Sigma-Aldrich

MISSION® esiRNA

targeting human RSAD2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Spedizione prevista il18 aprile 2025



Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00


Spedizione prevista il18 aprile 2025


Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTGAGCAATGGAAGCCTGATCCGGGAGAGGTGGTTCCAGAATTATGGTGAGTATTTGGACATTCTCGCTATCTCCTGTGACAGCTTTGACGAGGAAGTCAATGTCCTTATTGGCCGTGGCCAAGGAAAGAAGAACCATGTGGAAAACCTTCAAAAGCTGAGGAGGTGGTGTAGGGATTATAGAGTCGCTTTCAAGATAAATTCTGTCATTAATCGTTTCAACGTGGAAGAGGACATGACGGAACAGATCAAAGCACTAAACCCTGTCCGCTGGAAAGTGTTCCAGTGCCTCTTAATTGAGGGTGAGAATTGTGGAGAAGATGCTCTAAGAGAAGCAGAAAGATTTGTTATTGGTGATGAAGAATTTGAAAGATTCTTGGAGCGCCACAAAGAAGTGTCCTGCTTGGTGCCTGAATCTAACCAGAAGATGAAAGACTCCTACCTTATTCTGGATGAATATATGCGCTTTCTGAACTGTAGAAAGGGACGGAAGGA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

B Wang et al.
Placenta, 36(6), 667-673 (2015-03-31)
Viperin, a virus-inducible antiviral protein, has been reported to inhibit the replication of a variety of viruses. However, its expression and function in trophoblast cells remains unclear. Toll-like receptor 3 (TLR3) is a key component of the innate immune system
Ji-Su Jang et al.
Cell death & disease, 9(8), 823-823 (2018-08-03)
Dendritic cells (DCs) are the most potent professional antigen presenting cells and inducers of T cell-mediated immunity. However, few specific markers of mature DCs (mDC) have been reported. A previous microarray analysis revealed expression of mDC-specific genes and identified Rsad2
Keaton M Crosse et al.
Immunology and cell biology, 99(4), 373-391 (2020-11-02)
Viperin is an interferon-inducible protein that is pivotal for eliciting an effective immune response against an array of diverse viral pathogens. Here we describe a mechanism of viperin's broad antiviral activity by demonstrating the protein's ability to synergistically enhance the
José R Peña Cárcamo et al.
Virology, 514, 216-229 (2017-12-05)
Junín arenavirus infections are associated with high levels of interferons in both severe and fatal cases. Upon Junín virus (JUNV) infection a cell signaling cascade initiates, that ultimately attempts to limit viral replication and prevent infection progression through the expression

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.