Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU140721

Sigma-Aldrich

MISSION® esiRNA

targeting human CX3CR1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATCCAGACGCTGTTTTCCTGCAAGAACCACAAGAAAGCCAAAGCCATTAAACTGATCCTTCTGGTGGTCATCGTGTTTTTCCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGACGCTTAAGCTCTATGACTTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGCTGGCCCTCAGTGTGACTGAGACGGTTGCATTTAGCCATTGTTGCCTGAATCCTCTCATCTATGCATTTGCTGGGGAGAAGTTCAGAAGATACCTTTACCACCTGTATGGGAAATGCCTGGCTGTCCTGTGTGGGCGCTCAGTCCACGTTGATTTCTCCTCATCTGAATCACAAAGGAGCAGGCATGGAAGTGTTCTGAGCAGCAATTTTACTTACCACACGAGTGATGGAGATGCATTGCTCCTTCTCTGAAGGGA

N° accesso Ensembl | uomo

ENSG00000168329

N° accesso NCBI

NM_001337

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CX3CR1(1524) , CX3CR1(1524)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yoshimi Enose-Akahata et al.
Retrovirology, 9, 16-16 (2012-02-18)
The activation of mononuclear phagocytes (MPs), including monocytes, macrophages and dendritic cells, contributes to central nervous system inflammation in various neurological diseases. In HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP), MPs are reservoirs of HTLV-I, and induce proinflammatory cytokines and excess T
Lisa Rooper et al.
Journal of ovarian research, 6(1), 57-57 (2013-08-21)
The goal of this study was to determine a predominant cell type expressing fractalkine receptor (CX3CR1) in mature ovarian teratomas and to establish functional significance of its expression in cell differentiation. Specimens of ovarian teratoma and human fetal tissues were
Jun Tang et al.
Neuropharmacology, 119, 157-169 (2017-02-06)
Microglia play dual roles after germinal matrix hemorrhage, and the neurotrophic phenotype maybe neuroprotective. However, the phenotype transformation and the way by which neuron-microglia dialogue remain unclear. We raise the hypothesis that a cannabinoid receptor2 agonist (JWH133) accelerates the CX3CR1
Sheng-Mou Hou et al.
Arthritis research & therapy, 19(1), 282-282 (2017-12-23)
Osteoarthritis (OA) is a degenerative joint disease that affects the cartilage, synovium, and subchondral bone and is the leading cause of disability in older populations. Specific diagnostic biomarkers are lacking; hence, treatment options for OA are limited. Synovial inflammation is
Monika Siwetz et al.
Histochemistry and cell biology, 143(6), 565-574 (2015-01-09)
The chemokine fractalkine (CX3CL1) recently attracted increasing attention in the field of placenta research due to its dual nature, acting both as membrane-bound and soluble forms. While the membrane-bound form mediates flow-resistant adhesion of leukocytes to endothelial and epithelial cells

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.