Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU139421

Sigma-Aldrich

MISSION® esiRNA

targeting human CTNNB1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCCGGCTATTGTAGAAGCTGGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAACTGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGTCTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCAGCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAAGTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATCACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATGGCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCACCATCCCACT

N° accesso Ensembl | uomo

ENSG00000168036

N° accesso NCBI

NM_001098209

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CTNNB1(1499) , CTNNB1(1499)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
UBV
RYU
MWU
STU
ZRU

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Peng Kong et al.
Oncotarget, 8(70), 115089-115101 (2018-02-01)
Microwave ablation (MWA), a thermal ablation, is an effective treatment for breast cancer. However, residual breast cancer is still detected. The biological characteristics of residual breast cancer after thermal ablation remain unknown. To mimic insufficient MWA
Rob M Ewing et al.
Journal of proteome research, 17(6), 2216-2225 (2018-05-12)
The dysregulation of Wnt signaling is a frequent occurrence in many different cancers. Oncogenic mutations of CTNNB1/β-catenin, the key nuclear effector of canonical Wnt signaling, lead to the accumulation and stabilization of β-catenin protein with diverse effects in cancer cells.
Jie Liu et al.
Stem cells international, 2020, 5823676-5823676 (2020-10-09)
Human embryonic stem cells (hESCs) gradually accumulate abnormal karyotypes during long-term suboptimal culture, which hinder their application in regenerative medicine. Previous studies demonstrated that the activation of CTNNB1 might be implicated in this process. Hence, the hESC line with stably
Izabela Janus et al.
Acta veterinaria Hungarica, 64(1), 90-102 (2016-02-27)
Primary heart tumours affect less than 1% of dogs. Due to their rare incidence, every research showing the frequency of cardiac tumours is valuable. Routine diagnostics is often complemented with immunohistochemical analysis. This study was conducted on 110 patient records
Nianchun Hu et al.
Biochemical and biophysical research communications, 533(4), 1457-1463 (2020-12-04)
Oxycodone is a common type of opioid used for the treatment of moderate to severe pain. Besides its analgesic effects on neuron cells, the effects of oxycodone on other cell types are yet to be elucidated. We previously demonstrated that
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.