Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU136981

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Spedizione prevista il16 aprile 2025



Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00


Spedizione prevista il16 aprile 2025


Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGAAGCAGCAGATCCAGAGGCAGATCCTCATCGCTGAGTTCCAGAGGCAGCACGAGCAGCTCTCCCGGCAGCACGAGGCGCAGCTCCACGAGCACATCAAGCAACAACAGGAGATGCTGGCCATGAAGCACCAGCAGGAGCTGCTGGAACACCAGCGGAAGCTGGAGAGGCACCGCCAGGAGCAGGAGCTGGAGAAGCAGCACCGGGAGCAGAAGCTGCAGCAGCTCAAGAACAAGGAGAAGGGCAAAGAGAGTGCCGTGGCCAGCACAGAAGTGAAGATGAAGTTACAAGAATTTGTCCTCAATAAAAAGAAGGCGCTGGCCCACCGGAATCTGAACCACTGCATTTCCAGCGACCCTCGCTACTGGTACGGGAAAACGCAGCACAGTTCCCTTGACCAGAGTTCTCCACCCCAGAGCGGAGTGTCGACCTCCTATAACCACCCGGTCCTGGGAATGTACGACGCCAAAGATGACTTCCCTCTTAGGAAAACAGCTTCTGAACCGAATCTGAAATTACGGTCCAGGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Todd J Cohen et al.
Molecules and cells, 38(4), 343-348 (2015-03-03)
Fiber type-specific programs controlled by the transcription factor MEF2 dictate muscle functionality. Here, we show that HDAC4, a potent MEF2 inhibitor, is predominantly localized to the nuclei in fast/glycolytic fibers in contrast to the sarcoplasm in slow/oxidative fibers. The cytoplasmic
Ling X Zhang et al.
American journal of physiology. Cell physiology, 307(4), C358-C372 (2014-06-20)
We have recently shown that in vivo inhibition of histone deacetylase (HDAC) stimulates endogenous myocardial regeneration in infarcted hearts (Zhang L et al. J Pharmacol Exp Ther 341: 285-293, 2012). Furthermore, our observation demonstrates that HDAC inhibition promotes cardiogenesis, which
GuoLiang Zou et al.
Biochimie, 165, 90-99 (2019-05-13)
The cardioprotection of catalpol and its mechanism in diabetic cardiomyopathy (DCM) remains unclear. Here, mouse cardiomyocytes were treated with high glucose (HG) to establish a model of cellular injury induced by HG. In vitro experiments were carried out and confirmed that
Y Yang et al.
Oncogene, 30(19), 2207-2218 (2011-01-19)
The transcriptional activity of the androgen receptor (AR) is regulated by both ligand binding and post-translational modifications, including acetylation and small ubiquitin-like modifier (SUMO)ylation. Histone deacetylases (HDACs) are known to catalyze the removal of acetyl groups from both histones and
Jung-Won Lee et al.
Nature communications, 10(1), 1897-1897 (2019-04-25)
The cellular decision regarding whether to undergo proliferation or death is made at the restriction (R)-point, which is disrupted in nearly all tumors. The identity of the molecular mechanisms that govern the R-point decision is one of the fundamental issues

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.