Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU131981

Sigma-Aldrich

MISSION® esiRNA

targeting human HBP1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATTGGAGTTGCTGCAGTGTAATGAGAATTTGCCATCTTCACCTGGATATAACTCCTGTGATGAACACATGGAGCTTGATGACCTTCCTGAACTTCAGGCAGTTCAAAGTGATCCTACCCAATCTGGCATGTACCAGCTGAGTTCAGATGTTTCACATCAAGAATACCCAAGATCATCTTGGAACCAAAATACCTCAGACATACCAGAAACTACTTACCGTGAAAATGAGGTGGACTGGCTAACAGAATTGGCAAATATCGCGACCAGTCCACAAAGTCCACTGATGCAGTGCTCATTTTACAATAGATCATCTCCTGTACACATCATAGCCACTAGCAAAAGTTTACATTCCTATGCACGCCCTCCACCAGTGTCCTCTTCTTCGAAGAGTGAACCAGCCTTC

N° accesso Ensembl | uomo

ENSG00000105856

N° accesso NCBI

NM_012257

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... HBP1(26959) , HBP1(26959)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Zhiyong Yan et al.
FEBS letters, 588(17), 3038-3046 (2014-06-17)
We found that miR-96 is overexpressed in glioma, and its level inversely correlates with the survival of patients. The reduction in miR-96 abundance suppresses the proliferation and colony formation of glioma cells. The tumorigenicity of U-87 MG cells is reduced
Z Z Yao et al.
Journal of biological regulators and homeostatic agents, 34(2), 357-366 (2020-06-19)
This study aims to explore the effect of p38 mitogen-activated protein kinase and its downstream target HMG-box transcription factor 1 (HBP1) in the chondrocyte (CH) senescence caused by hyperosmotic stress. Human cartilage tissue with or without osteoarthritis (OA) were collected
Ruo-Chia Tseng et al.
Journal of cellular and molecular medicine, 18(9), 1752-1761 (2014-06-05)
β-catenin nuclear accumulation is frequently identified in human non-small cell lung cancer (NSCLC). The HMG-box transcription factor 1 (HBP1) is a known repressor of β-catenin transactivation. However, the role of HBP1 in relation to β-catenin nuclear accumulation has not been

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.