Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU131781

Sigma-Aldrich

MISSION® esiRNA

targeting human MUL1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAGAAGCTCCAGGAAAATGCGTGCCTTATGCTGTTATAGAAGGAGCTGTGCGGTCTGTTAAAGAAACGCTTAACAGCCAGTTTGTGGAAAACTGCAAGGGGGTAATTCAGCGGCTGACACTTCAGGAGCACAAGATGGTGTGGAATCGAACCACCCACCTTTGGAATGATTGCTCAAAGATCATTCATCAGAGGACCAACACAGTGCCCTTTGACCTGGTGCCCCACGAGGATGGCGTGGATGTGGCTGTGCGAGTGCTGAAGCCCCTGGACTCAGTGGATCTGGGTCTAGAGACTGTGTATGAGAAGTTCCACCCCTCGATTCAGTCCTTCACCGATGTCATCGGCCACTACATCAGCGGTGAGCGGCCCAAAGGCATCCAAGAGACCGAGGAGATGCTGAAGGTGGGGGCCACCCTCACAGGGGTTGGCGAACTGGTCCTGGACAACAACTCTGTCCGCCT

N° accesso Ensembl | uomo

ENSG00000090432

N° accesso NCBI

NM_024544

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MUL1(79594) , MUL1(79594)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yanfang Zhao et al.
Biochimica et biophysica acta, 1863(11), 2871-2881 (2017-08-08)
The pathogenesis of cardiac hypertrophy is tightly associated with mitochondrial dysfunction. Disequilibrium of mitochondrial dynamic is one of the main drivers in the pathological processes during development of various cardiac diseases. However, the effect of mitochondrial dynamics on cardiac hypertrophy
Sun-Yong Kim et al.
Oncotarget, 6(32), 33382-33396 (2015-10-10)
Recent research on non-thermal plasma (NTP, an ionized gas) has identified it as a novel cancer therapeutic tool. However, the molecular mechanism remains unclear. In this study, we demonstrated NTP induced cell death of head and neck cancer (HNC) through
Jina Yun et al.
eLife, 3, e01958-e01958 (2014-06-06)
Parkinson's disease (PD) genes PINK1 and parkin act in a common pathway that regulates mitochondrial integrity and quality. Identifying new suppressors of the pathway is important for finding new therapeutic strategies. In this study, we show that MUL1 suppresses PINK1
Rajat Puri et al.
Nature communications, 10(1), 3645-3645 (2019-08-15)
Chronic mitochondrial stress associates with major neurodegenerative diseases. Recovering stressed mitochondria constitutes a critical step of mitochondrial quality control and thus energy maintenance in early stages of neurodegeneration. Here, we reveal Mul1-Mfn2 pathway that maintains neuronal mitochondrial integrity under stress

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.