Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU130921

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFBI

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATCACCAACAACATCCAGCAGATCATTGAGATCGAGGACACCTTTGAGACCCTTCGGGCTGCTGTGGCTGCATCAGGGCTCAACACGATGCTTGAAGGTAACGGCCAGTACACGCTTTTGGCCCCGACCAATGAGGCCTTCGAGAAGATCCCTAGTGAGACTTTGAACCGTATCCTGGGCGACCCAGAAGCCCTGAGAGACCTGCTGAACAACCACATCTTGAAGTCAGCTATGTGTGCTGAAGCCATCGTTGCGGGGCTGTCTGTAGAGACCCTGGAGGGCACGACACTGGAGGTGGGCTGCAGCGGGGACATGCTCACTATCAACGGGAAGGCGATCATCTCCAATAAAGACATCCTAGCCACCAACGGGGTGATCCACTACATTGATGAGCTACTCATCCCAGACTCAGCCA

N° accesso Ensembl | uomo

ENSG00000120708

N° accesso NCBI

NM_000358

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... TGFBI(7045) , TGFBI(7045)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Huan He et al.
Oncogene, 37(19), 2586-2600 (2018-02-23)
A critical mechanism that has been proposed for transcription regulation by estrogen receptor α (ER) is the tethering of ER to DNA via other transcription factors, such as AP-1. However, genome-wide assessment of the overlap in chromatin binding repertoires of
Bingyan Li et al.
BMC cancer, 12, 239-239 (2012-06-15)
Transforming growth factor β induced (TGFBI) product, an extracellular matrix (ECM) protein, has been implicated as a putative tumor suppressor in recent studies. Our previous findings revealed that expression of TGFBI gene is down-regulated in a variety of cancer cell
Tianhong Pan et al.
Neoplasia (New York, N.Y.), 20(1), 32-43 (2017-12-01)
Bone metastasis is common in renal cell carcinoma (RCC), and the lesions are mainly osteolytic. The mechanism of bone destruction in RCC bone metastasis is unknown. We used a direct intrafemur injection of mice with bone-derived 786-O RCC cells (Bo-786)

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.