Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU129521

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL12

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAAGTAAGCACAACAGCCAAAAAGGACTTTCCGCTAGACCCACTCGAGGAAAACTAAAACCTTGTGAGAGATGAAAGGGCAAAGACGTGGGGGAGGGGGCCTTAACCATGAGGACCAGGTGTGTGTGTGGGGTGGGCACATTGATCTGGGATCGGGCCTGAGGTTTGCCAGCATTTAGACCCTGCATTTATAGCATACGGTATGATATTGCAGCTTATATTCATCCATGCCCTGTACCTGTGCACGTTGGAACTTTTATTACTGGGGTTTTTCTAAGAAAGAAATTGTATTATCAACAGCATTTTCAAGCAGTTAGTTCCTTCATGATCATCACAATCATCATCATTCTCATTCTCATTTTTTAAATCAACGAGTACTTCAAGATCTGAATTTGGCTTGTTTGGAGC

N° accesso Ensembl | uomo

ENSG00000107562

N° accesso NCBI

NM_000609

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CXCL12(6387) , CXCL12(6387)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Kangling Xie et al.
American journal of physiology. Cell physiology, 319(3), C579-C588 (2020-07-02)
Identification of specific biomarkers for ischemic stroke is necessary due to their abilities to improve treatment outcomes. Many studies have demonstrated the involvement of microRNAs (miRNAs) in the pathogenesis and complications of ischemic stroke and patient outcomes. We found that
Timo Rademakers et al.
Scientific reports, 7, 45263-45263 (2017-03-30)
During plaque progression, inflammatory cells progressively accumulate in the adventitia, paralleled by an increased presence of leaky vasa vasorum. We here show that next to vasa vasorum, also the adventitial lymphatic capillary bed is expanding during plaque development in humans
Guan-Xi Liu et al.
Brain, behavior, and immunity, 84, 72-79 (2019-11-22)
Conditioned place preference (CPP) is a learned behavior, in which animals learn to associate environmental contexts with rewarding effects. The formation of CPP is an integrated outcome of multiple learning processes. Although multiple anatomical substrates underlying this contextual learning have
Xiaoming Zhu et al.
Experimental cell research, 375(2), 41-50 (2019-01-07)
Cancer-associated fibroblasts (CAFs) play critical roles in tumor progression. However, the role and mechanism underlying CAFs in esophageal cancer (EC) remain unclear. In this study, primary CAFs and normal esophageal fibroblasts (NOFs) were isolated and characterized by immunofluorescence, qRT-PCR and
S J Han et al.
Cell death & disease, 6, e1863-e1863 (2015-08-28)
High-mobility group box 1 (HMGB1) functions as a transcription-enhancing nuclear protein as well as a crucial cytokine that regulates inflammation. This study demonstrated that secretion of HMGB1 due to ultraviolet (UV) radiation inducing ocular surface inflammation-mediated reactive oxygen species (ROS)

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.