Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU127961

Sigma-Aldrich

MISSION® esiRNA

targeting human NCF1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCCAGCCAGCACTATGTGTACATGTTCCTGGTGAAATGGCAGGACCTGTCGGAGAAGGTGGTCTACCGGCGCTTCACCGAGATCTACGAGTTCCATAAAACCTTAAAAGAAATGTTCCCTATTGAGGCAGGGGCGATCAATCCAGAGAACAGGATCATCCCCCACCTCCCAGCTCCCAAGTGGTTTGACGGGCAGCGGGCCGCCGAGAACCGCCAGGGCACACTTACCGAGTACTGCGGCACGCTCATGAGCCTGCCCACCAAGATCTCCCGCTGTCCCCACCTCCTCGACTTCTTCAAGGTGCGCCCTGATGACCTCAAGCTCCCCACGGACAACCAGACAAAAAAGCCAGAGACATACTTGATGCCCAAAGATGGCAAGAGTACCGCGACAGACATCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hyo Jung Shin et al.
Polymers, 12(2) (2020-02-20)
Osteoarthritis (OA) is the most common joint disorder that has had an increasing prevalence due to the aging of the population. Recent studies have concluded that OA progression is related to oxidative stress and reactive oxygen species (ROS). ROS are
Dehong Yan et al.
The Journal of experimental medicine, 217(2) (2019-10-31)
Myeloid-derived suppressor cells (MDSCs) are "polarized" myeloid cells that effectively promote tumorigenesis by inhibiting antitumor immunity. How myeloid cells acquire the protumoral properties during tumorigenesis is poorly understood. We report here that the polarity protein TIPE2 (tumor necrosis factor-α-induced protein
Tian Wang et al.
Biochemical and biophysical research communications, 489(4), 361-368 (2017-05-10)
In acute lung injury/acute respiratory distress syndrome (ALI/ARDS), pathogenesis is associated with the regulation of macrophage-generated oxidative stress, and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-derived reactive oxygen species(ROS) are key to regulating oxidative stress. In the present study, we
Bharatwaj Sowrirajan et al.
Scientific reports, 7, 43441-43441 (2017-02-28)
Interleukin (IL)-27, a member of the IL-12 cytokine family, plays an important and diverse role in the function of the immune system. We have previously demonstrated that IL-27 is an anti-viral cytokine which inhibits HIV-1, HIV-2, Influenza virus and herpes
Matthew R DiStasi et al.
American journal of physiology. Heart and circulatory physiology, 306(10), H1435-H1443 (2014-03-19)
The role of NADPH oxidase (Nox) in both the promotion and impairment of compensatory collateral growth remains controversial because the specific Nox and reactive oxygen species involved are unclear. The aim of this study was to identify the primary Nox

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.