Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU126811

Sigma-Aldrich

MISSION® esiRNA

targeting human MRC1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCTGGTGGAAGAAGAAGCAGTCTTTCTTATGAAGATGCTGACTGTGTTGTTATTATTGGAGGTGCATCAAATGAAGCAGGAAAATGGATGGATGATACCTGCGACAGTAAACGAGGCTACATATGCCAGACACGATCCGACCCTTCCTTGACTAATCCTCCAGCAACGATTCAAACAGATGGCTTTGTTAAATATGGCAAAAGCAGCTATTCACTCATGAGACAAAAATTTCAATGGCATGAAGCGGAGACATACTGCAAGCTTCACAATTCCCTTATAGCCAGCATTCTGGATCCCTACAGTAATGCATTTGCGTGGCTGCAGATGGAAACATCTAATGAACGTGTGTGGATCGCCCTGAACAGTAACTTGACTGATAATCAATACACTTGGACTGATAAGTGGAGGGTGAGGTACACTAACTGGGCTGCTGATG

N° accesso Ensembl | uomo

ENSG00000120586

N° accesso NCBI

NM_002438

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MRC1(4360) , MRC1(4360)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jinjian Huang et al.
Bioactive materials, 6(3), 770-782 (2020-10-08)
Herein, we report the synthesis of a biomimic hydrogel adhesive that addresses the poor healing of surgical anastomosis. Dopamine-conjugated xanthan gum (Da-g-Xan) is fabricated using deep insights into the molecular similarity between mussels' adhesive and dopamine as well as the
Gregor Olmes et al.
Arthritis research & therapy, 18, 90-90 (2015-01-01)
The role of macrophages in the pathogenesis of lupus nephritis, in particular their differentiation to a certain subtype (e.g., M1- or M2-like) modulating the inflammatory reaction, is unknown. Here we investigated whether the differentiation in M1- or M2-like macrophages depends
Tae-Wook Chung et al.
Oncotarget, 8(3), 4436-4448 (2016-12-30)
Tumor-derived gangliosides in the tumor microenvironment are involved in the malignant progression of cancer. However, the molecular mechanisms underlying the effects of gangliosides shed from tumors on macrophage phenotype remain unknown. Here, we showed that ganglioside GM1 highly induced the

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.