Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU126681

Sigma-Aldrich

MISSION® esiRNA

targeting human APRT

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGCACCTGTACCCTTCTTCTCTCTCCTGCAGTATGAGTGACCACAGGGCCTCCCAGCCCAACATCTCCAGCTGGATCCCAGGGAAATATCAGCCTTGGGCAACTGCAGTGACCAGGGGCACCGGCTGCCCACAGGGAACACATTCCTTTGCTGGGGTTCAGCGCCTCTCCTGGGGCTGGAAGTGCCAAAGCCTGGGGCAAAGCTGTGTTTCAGCCACACTGAACC

N° accesso Ensembl | uomo

ENSG00000198931

N° accesso NCBI

NM_000485

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... APRT(353) , APRT(353)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jon Pey et al.
Scientific reports, 7(1), 14358-14358 (2017-11-01)
Constraint-based modeling for genome-scale metabolic networks has emerged in the last years as a promising approach to elucidate drug targets in cancer. Beyond the canonical biosynthetic routes to produce biomass, it is of key importance to focus on metabolic routes
Yi-Fang Cheng et al.
PloS one, 10(11), e0142283-e0142283 (2015-11-07)
The AMP-activated protein kinase (AMPK) signaling system plays a key role in cellular stress by repressing the inflammatory responses induced by the nuclear factor-kappa B (NF-κB) system. Previous studies suggest that the anti-inflammatory role of AMPK involves activation by adenine

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.