EHU126001
MISSION® esiRNA
targeting human OTUD1
Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
About This Item
Codice UNSPSC:
41105324
NACRES:
NA.51
Descrizione
Powered by Eupheria Biotech
Livello qualitativo
Nome Commerciale
MISSION®
Stato
lyophilized powder
Sequenza bersaglio del cDNA di esiRNA
ACTACATCGCCGACCATCTCGACCACTTCAGCCCCCTGATTGAGGGCGACGTGGGGGAGTTTATCATCGCTGCTGCCCAAGACGGGGCATGGGCCGGGTACCCGGAGTTGCTGGCCATGGGGCAGATGCTGAATGTGAATATCCATTTAACTACTGGAGGGAGGCTGGAGAGTCCCACGGTGTCTACCATGATTCATTATTTGGGCCCAGAG
N° accesso Ensembl | uomo
N° accesso NCBI
Condizioni di spedizione
ambient
Temperatura di conservazione
−20°C
Informazioni sul gene
human ... OTUD1(220213) , OTUD1(220213)
Descrizione generale
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Note legali
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Scegli una delle versioni più recenti:
Possiedi già questo prodotto?
I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.
Shudong Piao et al.
Cellular signalling, 33, 22-29 (2017-02-22)
Ubiquitination and deubiquitination pathways play important roles in the regulation of p53 stability and activity. p53 is ubiquitinated and destabilized by E3 ubiquitin ligases and is deubiquitinated and stabilized by deubiquitinases (DUBs). We screened ovarian tumor (OTU) subfamily proteins to
Fan Yao et al.
Nature communications, 9(1), 2269-2269 (2018-06-13)
Dysregulation of YAP localization and activity is associated with pathological conditions such as cancer. Although activation of the Hippo phosphorylation cascade is known to cause cytoplasmic retention and inactivation of YAP, emerging evidence suggests that YAP can be regulated in
Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..
Contatta l'Assistenza Tecnica.