Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU121451

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHB3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGCAACATCCTTGTCAACAGCAACCTGGTCTGCAAAGTCTCAGACTTTGGCCTCTCCCGCTTCCTGGAGGATGACCCCTCCGATCCTACCTACACCAGTTCCCTGGGCGGGAAGATCCCCATCCGCTGGACTGCCCCAGAGGCCATAGCCTATCGGAAGTTCACTTCTGCTAGTGATGTCTGGAGCTACGGAATTGTCATGTGGGAGGTCATGAGCTATGGAGAGCGACCCTACTGGGACATGAGCAACCAGGATGTCATCAATGCCGTGGAGCAGGATTACCGGCTGCCACCACCCATGGACTGTCCCACAGCACTGCACCAGCTCATGCTGGACTGCTGGGTGCGGGACCGGAACCTCAGGCCCAAATTCTCCCAGATTGTCAATACCCTGGACAAGCTCATCC

N° accesso Ensembl | uomo

ENSG00000182580

N° accesso NCBI

NM_004443

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... EPHB3(2049) , EPHB3(2049)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ACNV
JUU
NRR
DOR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Guodong Zhang et al.
Cancer science, 108(3), 408-418 (2017-04-04)
microRNAs play key roles during various crucial cell processes such as proliferation, migration, invasion and apoptosis. Also, microRNAs have been shown to possess oncogenic and tumor-suppressive functions in human cancers. Here, we describe the regulation and function of miR-149 in
Bo Gun Jang et al.
Biomolecules, 10(4) (2020-04-17)
The protein tyrosine kinase Ephrin type-B receptor 3 (EPHB3) is expressed in cells at the base of intestinal crypts, acting as a cellular guide in the maintenance of intestinal crypt architecture. We aimed to investigate the expression profile of EPHB3
Seong Hye Park et al.
Theranostics, 9(8), 2235-2251 (2019-06-01)
A major problem of colorectal cancer (CRC) targeted therapies is relapse caused by drug resistance. In most cases of CRC, patients develop resistance to anticancer drugs. Cetuximab does not show many of the side effects of other anticancer drugs and
Benjamin Lin et al.
Nature communications, 6, 6619-6619 (2015-04-09)
Directed cell migration in native environments is influenced by multiple migratory cues. These cues may include simultaneously occurring attractive soluble growth factor gradients and repulsive effects arising from cell-cell contact, termed contact inhibition of locomotion (CIL). How single cells reconcile

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.