Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU120531

Sigma-Aldrich

MISSION® esiRNA

targeting human USP22

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00

Check Cart for Availability
Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00

Check Cart for Availability

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGTTGCCATAGCTACCAGGAGTCCACAAAGCAGCTCACTATGAAGAAACTGCCCATCGTAGCCTGTTTTCATCTCAAACGATTTGAACACTCAGCCAAGCTGCGGCGGAAGATCACCACGTATGTGTCCTTCCCCCTGGAGCTGGACATGACCCCTTTCATGGCCTCCAGCAAAGAGAGCAGGATGAATGGACAGTACCAGCAGCCCACGGACAGTCTCAACAATGACAACAAGTATTCCCTGTTTGCTGTTGTTAACCATCAAGGGACCTTGGAGAGTGGCCACTACACCAGCTTTATCCGGCAGCACAAAGACCAGTGGTTCAAGTGTGACGATGCCATCATCACCAAGGCCAGCATCAAGGACGTCCTGGACAGCGAAGGGTACTTGCTGTTCTATCACAAACAGTTCCTGGAATACGAGTAGCCTTATCTGCAGCTGGTCAGAAAAACAAAGGCAATGCATTGGCAAGCCTCACAAAGT

N° accesso Ensembl | uomo

ENSG00000124422

N° accesso NCBI

NM_015276

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... USP22(23326) , USP22(23326)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
IDV
XZU
ZYU
OWU
RUU

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Dongyeon Kim et al.
Journal of cellular physiology, 232(12), 3664-3676 (2017-02-06)
The proto-oncogene c-Myc has a pivotal function in growth control, differentiation, and apoptosis and is frequently affected in human cancer, including breast cancer. Ubiquitin-specific protease 22 (USP22), a member of the USP family of deubiquitinating enzymes (DUBs), mediates deubiquitination of
An-Long Ji et al.
World journal of gastroenterology, 25(7), 824-836 (2019-02-28)
Intestinal ischemia reperfusion (I/R) injury is a serious but common pathophysiological process of many diseases, resulting in a high mortality rate in clinical practice. Ubiquitin-specific protease 22 (USP22) acts as regulator of cell cycle progression, proliferation, and tumor invasion. Depleted
Gaojun Xu et al.
Experimental cell research, 362(2), 268-278 (2017-11-28)
MicroRNA-30e-5p (miR-30e-5p) is a tumor suppressor that is known to be downregulated in non-small cell lung cancer (NSCLC). However, how miR-30e-5p inhibits NSCLC tumorigenesis is not known. Ubiquitin-specific peptidase 22 (USP22) is upregulated in NSCLC and promotes tumorigenesis via a
R-Q Xin et al.
European review for medical and pharmacological sciences, 24(19), 9932-9939 (2020-10-23)
MicroRNA-329-3p (miR-329-3p) has been shown to be involved in tumor development. But its role in hepatocellular carcinoma has not been explored. Our study aims to explore the effect and mechanism of miR-329-3p on hepatocellular carcinoma development. Hepatocellular carcinoma tissues and
Ying Lin et al.
Oncology letters, 20(5), 246-246 (2020-09-26)
Renal cell carcinoma (RCC) is one of the commonest urological tumors. The incidence of RCC ranks third among urological tumors, after prostate cancer and bladder tumors. However, the etiology of RCC remains unclear. Ubiquitin-specific protease 22 (USP22), a potential marker
Visualizza tutti i documenti correlati

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.