Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU120331

Sigma-Aldrich

MISSION® esiRNA

targeting human RHOB

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCCACCGTCTTCGAGAACTATGTGGCCGACATTGAGGTGGACGGCAAGCAGGTGGAGCTGGCGCTGTGGGACACGGCGGGCCAGGAGGACTACGACCGCCTGCGGCCGCTCTCCTACCCGGACACCGACGTCATTCTCATGTGCTTCTCGGTGGACAGCCCGGACTCGCTGGAGAACATCCCCGAGAAGTGGGTCCCCGAGGTGAAGCACTTCTGTCCCAATGTGCCCATCATCCTGGTGGCCAACAAAAAAGACCTGCGCAGCGACGAGCATGTCCGCACAGAGCTGGCCCGCATGAAGCAGGAACCCGTGCGCACGGATGACGGCCGCGCCATGGCCGTGCGCATCCAAGCCTACGACTACCTCGAGTGCTCTGCCAAGACCAAGGAAGGCGTGCGCGAGGTCTTCGAGACGGCCACGCGCGCCGCGCTGCAGAAGCGCTACGGCTCCCAGAACGGCTGCATCAACTGCTGCAAGGTGCTATGAG

N° accesso Ensembl | uomo

ENSG00000143878

N° accesso NCBI

NM_004040

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... RHOB(388) , RHOB(388)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Olivier Calvayrac et al.
EMBO molecular medicine, 9(2), 238-250 (2016-12-23)
Although lung cancer patients harboring EGFR mutations benefit from treatment with EGFR-tyrosine kinase inhibitors (EGFR-TKI), most of them rapidly relapse. RHOB GTPase is a critical player in both lung carcinogenesis and the EGFR signaling pathway; therefore, we hypothesized that it
Li-Juan Wei et al.
Chemico-biological interactions, 289, 9-14 (2018-04-17)
MicroRNAs (miRNAs) can function as tumor suppressor or oncogenic genes. The putative targets of miR-223 include tumor suppressor gene, RhoB. Here we sought to investigate the role of miR-223-RhoB signaling pathway in proliferation of colon cancer. We used Western blot
Shariq S Ansari et al.
Cellular oncology (Dordrecht), 40(1), 89-96 (2016-11-05)
Recently, we found that erufosine (erucylphospho-N,N,N trimethylpropylammonium) can induce up-regulation of RhoB expression in oral squamous carcinoma (OSCC) cells, thereby hinting at a tumor suppressive role. Therefore, we aimed to evaluate the role of RhoB in the tumor suppressive mode
Manon C A Pronk et al.
Molecular biology of the cell, 30(5), 607-621 (2019-01-03)
Rho GTPases control both the actin cytoskeleton and adherens junction stability and are recognized as essential regulators of endothelial barrier function. They act as molecular switches and are primarily regulated by the exchange of GDP and GTP. However, posttranslational modifications

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.