Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU116371

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATGTTGGAAAGCATCAGGAAAGAGGTTAAAGGAGACCTGGAAAATGCTTTCCTGAACCTGGTTCAGTGCATTCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATGAAGGGCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAAGTGGACATGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTATTATATCCAGCAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGTGGAGATGACTGAAGCCCGACACGGCCTGAGCGTCCAGAAATGGTGCTCACCATGCTTCCAGCTAACAGGTCTAGAAAACCAGCTTGCGAATAACAGTCCCCGTGGCCATCCCTGTGAGGGTGACGTTAGCA

N° accesso Ensembl | uomo

ENSG00000182718

N° accesso NCBI

NM_001002858

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ANXA2(302) , ANXA2(302)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yuanhong Chang et al.
Oncology reports, 40(6), 3625-3634 (2018-10-03)
Recently, long non-coding RNA (lncRNA) FOXD2 adjacent opposite strand RNA 1 (FOXD2-AS1) has been recognized to function as an oncogene in several human tumors, and FOXD2‑AS1 dysregulation has been closely associated with carcinogenesis and tumor progression. Nevertheless, the correlation between the
Yan Liu et al.
Oncology reports, 37(6), 3643-3650 (2017-04-26)
Annexin A2 is a member of the Annexin family that acts as a Ca2+-dependent phospholipid and membrane binding protein, which is associated with the survival and spread of multiple neoplasms. However, the function of Annexin A2 in ovarian cancer progression remains unclear.
Weining Wu et al.
Journal of experimental & clinical cancer research : CR, 38(1), 133-133 (2019-03-23)
Glioblastoma multiforme (GBM) is the most common and aggressive form of astrocytoma among adult brain tumors. Multiple studies have shown that long non-coding RNAs (lncRNAs) play important roles in acting as molecular sponge for competing with microRNAs (miRNAs) to regulate
Jie Liu et al.
BMC biochemistry, 4, 10-10 (2003-09-10)
Annexin II heavy chain (also called p36, calpactin I) is lost in prostate cancers and in a majority of prostate intraepithelial neoplasia (PIN). Loss of annexin II heavy chain appears to be specific for prostate cancer since overexpression of annexin
Isah Abubakar Aliyu et al.
Viruses, 11(4) (2019-04-12)
Recent evidence has demonstrated that dengue virus requires active filopodia formation for a successful infection. However, the cellular factor involved in the interaction has not been fully elucidated. We used a combination of virus overlay protein binding assay and LC-MS/MS
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.