Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU113241

Sigma-Aldrich

MISSION® esiRNA

targeting human G3BP1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAGCCTCAGGAGGAGTCTGAAGAAGAAGTAGAGGAACCTGAAGAAAGACAGCAAACACCTGAGGTGGTACCTGATGATTCTGGAACTTTCTATGATCAGGCAGTTGTCAGTAATGACATGGAAGAACATTTAGAGGAGCCTGTTGCTGAACCAGAGCCTGATCCTGAACCAGAACCAGAACAAGAACCTGTATCTGAAATCCAAGAGGAAAAGCCTGAGCCAGTATTAGAAGAAACTGCCCCTGAGGATGCTCAGAAGAGTTCTTCTCCAGCACCTGCAGACATAGCTCAGACAGTACAGGAAGACTTGAGGACATTTTCTTGGGCATCTGTGACCAGTAAGAATCTTCCACCCAGTGGAGCTGTTCCAGTTACTGGGATACCACCTCATGTTGTTAAAGTACCAGCTTCACAGCCC

N° accesso Ensembl | uomo

ENSG00000145907

N° accesso NCBI

NM_005754

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... G3BP1(10146) , G3BP1(10146)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ning Dou et al.
American journal of cancer research, 6(11), 2641-2650 (2016-12-03)
RasGAP SH3-domain-Binding Protein 1 (G3BP1) has been implicated in cell growth, migration, and metastasis of some cancers, yet its function in hepatocellular carcinoma (HCC) remains to be explored. In the present study, we reported that G3BP1 was upregulated in HCC
Amr Omer et al.
EMBO reports, 19(5) (2018-03-30)
Cellular senescence is a physiological response by which an organism halts the proliferation of potentially harmful and damaged cells. However, the accumulation of senescent cells over time can become deleterious leading to diseases and physiological decline. Our data reveal a
Amr Omer et al.
Nature communications, 11(1), 4979-4979 (2020-10-07)
Cellular senescence is a known driver of carcinogenesis and age-related diseases, yet senescence is required for various physiological processes. However, the mechanisms and factors that control the negative effects of senescence while retaining its benefits are still elusive. Here, we
Allison B Herman et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(10), 2014-2027 (2019-08-30)
Stress granules (SGs) are dynamic cytoplasmic aggregates containing mRNA, RNA-binding proteins, and translation factors that form in response to cellular stress. SGs have been shown to contribute to the pathogenesis of several human diseases, but their role in vascular diseases
David Pla-Martín et al.
The EMBO journal, 39(9), e102731-e102731 (2020-03-10)
Mitochondria house anabolic and catabolic processes that must be balanced and adjusted to meet cellular demands. The RNA-binding protein CLUH (clustered mitochondria homolog) binds mRNAs of nuclear-encoded mitochondrial proteins and is highly expressed in the liver, where it regulates metabolic

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.