Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU111751

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTGAACCCCAAGCTGATAGGAAGATGTCTTCAGGAAATGCTAAAATTGGGCACCCTGCCCCCAACTTCAAAGCCACAGCTGTTATGCCAGATGGTCAGTTTAAAGATATCAGCCTGTCTGACTACAAAGGAAAATATGTTGTGTTCTTCTTTTACCCTCTTGACTTCACCTTTGTGTGCCCCACGGAGATCATTGCTTTCAGTGATAGGGCAGAAGAATTTAAGAAACTCAACTGCCAAGTGATTGGTGCTTCTGTGGATTCTCACTTCTGTCATCTAGCATGGGTCAATACACCTAAGAAACAAGGAGGACTGGGACCCATGAACATTCCTTTGGTATCAGACCCGAAGCGCACCATTGCTCAGGATTATGGGGTCTTAAAGGCTGATGAAGGCATCTCGTTCAGGGGCCTTTTTATCATTGATGATAAGGGTATTCTTCGGCAGATCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

N Cong et al.
European review for medical and pharmacological sciences, 22(7), 1922-1928 (2018-04-25)
Peroxiredoxin1 (PRDX1), a class of thiol peroxidases, is a multifunctional protein. We aimed at analyzing the effect of PRDX1 on proliferation, apoptosis, migration and invasion of colorectal cancer and to investigate the potential mechanism. Western blot and PCR were used
Jean-Louis Guéant et al.
Nature communications, 9(1), 67-67 (2018-01-06)
To date, epimutations reported in man have been somatic and erased in germlines. Here, we identify a cause of the autosomal recessive cblC class of inborn errors of vitamin B
Qing Ye et al.
Cell chemical biology, 26(3), 366-377 (2019-01-22)
Peroxiredoxin 1 (Prx1) and glutaredoxin 3 (Grx3) are two major antioxidant proteins that play a critical role in maintaining redox homeostasis for tumor progression. Here, we identify the prototypical pyranonaphthoquinone natural product frenolicin B (FB) as a selective inhibitor of
Jung Mi Lim et al.
The Journal of cell biology, 210(1), 23-33 (2015-07-08)
Proteins associated with the centrosome play key roles in mitotic progression in mammalian cells. The activity of Cdk1-opposing phosphatases at the centrosome must be inhibited during early mitosis to prevent premature dephosphorylation of Cdh1-an activator of the ubiquitin ligase anaphase-promoting
Min Zhang et al.
Oncology letters, 10(3), 1841-1847 (2015-12-02)
Peroxiredoxin 1 (Prx1) has a significant role in several malignant types of tumor. However, the role of Prx1 in oral leukoplakia (OLK) has remained to be elucidated. OLK is a common precancerous lesion of the oral mucosa that has a

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.