Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU106961

Sigma-Aldrich

MISSION® esiRNA

targeting human FKBP1A

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAATGACAGGAATGGCCTCCTCCCTTAGCTCCCTGTTCTTGGATCTGCCATGGAGGGATCTGGTGCCTCCAGACATGTGCACATGAATCCATATGGAGCTTTTCCTGATGTTCCACTCCACTTTGTATAGACATCTGCCCTGACTGAATGTGTTCTGTCACTCAGCTTTGCTTCCGACACCTCTGTTTC

N° accesso Ensembl | uomo

ENSG00000088832

N° accesso NCBI

NM_000801

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FKBP1A(2280) , FKBP1A(2280)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Mingyou Xing et al.
Cancer chemotherapy and pharmacology, 84(4), 861-872 (2019-08-21)
FK506-binding protein 12 (FKBP12) is abundant, ubiquitously expressed cytoplasmic protein with multiple functions in cell signaling transduction. Recently, we reported a novel function for FKBP12 in oncoprotein mouse double minute 2 (MDM2) self-ubiquitination and degradation, which greatly enhanced the sensitivity
Zicheng Wang et al.
Journal of cell science, 132(10) (2019-04-28)
Necroptosis is a regulated form of necrotic cell death that is mediated by receptor-interacting serine/threonine-protein kinase 1 (RIPK1), RIPK3 and mixed-lineage kinase domain-like protein (MLKL), which mediates necroptotic signal transduction induced by tumor necrosis factor (TNF). Although many target proteins
Itziar M D Posada et al.
Oncotarget, 8(27), 44550-44566 (2017-06-01)
Currently several combination treatments of mTor- and Ras-pathway inhibitors are being tested in cancer therapy. While multiple feedback loops render these central signaling pathways robust, they complicate drug targeting.Here, we describe a novel H-ras specific feedback, which leads to an
Tanner Stokes et al.
Cell reports, 32(5), 107980-107980 (2020-08-07)
Loading of skeletal muscle changes the tissue phenotype reflecting altered metabolic and functional demands. In humans, heterogeneous adaptation to loading complicates the identification of the underpinning molecular regulators. A within-person differential loading and analysis strategy reduces heterogeneity for changes in

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.