Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU100561

Sigma-Aldrich

MISSION® esiRNA

targeting human CLEC7A

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGCACCCAGCCTAGAATCTTGTATAATATGTAATTGTAGGGAAACTGCTCTCATAGGAAAGTTTTCTGCTTTTTAAATACAAAAATACATAAAAATACATAAAATCTGATGATGAATATAAAAAAGTAACCAACCTCATTGGAACAAGTATTAACATTTTGGAATATGTTTTATTAGTTTTGTGATGTACTGTTTTACAATTTTTACCATTTTTTTCAGTAATTACTGTAAAATGGTATTATTGGAATGAAACTATATTTCCTCATGTGCTGATTTGTCTTATTTTTTTCATACTTTCCCACTGGTGC

N° accesso Ensembl | uomo

ENSG00000172243

N° accesso NCBI

NM_022570

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CLEC7A(64581) , CLEC7A(64581)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Nobuaki Fujiwara et al.
Cancer gene therapy, 26(1-2), 32-40 (2018-07-05)
Antisense oligonucleotides (AS-ODNs) hybridize with specific mRNAs, resulting in interference with the splicing mechanism or the regulation of protein translation. We previously demonstrated that the β-glucan schizophyllan (SPG) can form a complex with AS-ODNs with attached dA40 (AS-ODNs/SPG), and this
Kelan Yuan et al.
International immunopharmacology, 52, 168-175 (2017-09-20)
To investigate the role of phosphorylated JNK in Dectin-1-induced IL-1β production and the role of Dectin-1 in apoptosis in mouse Aspergillus fumigatus (A. fumigatus) keratitis. Mice corneas were pretreated with Dectin-1 siRNA or SP600125 (the inhibitor of JNK) before A.
Esther Weiss et al.
Frontiers in cellular and infection microbiology, 8, 288-288 (2018-09-05)
Invasive aspergillosis (IA) is an infectious disease caused by the fungal pathogen Aspergillus fumigatus that mainly affects immunocompromised hosts. To investigate immune cell cross-talk during infection with A. fumigatus, we co-cultured natural killer (NK) cells and dendritic cells (DC) after
Cheng-Ye Che et al.
International journal of ophthalmology, 11(6), 905-909 (2018-07-07)
To investigate the regulation of lipoxygenase (LOX)-1 and Dectin-1 on interleukin-10 (IL-10) production in mice with Aspergillus fumigatus (A. fumigatus) keratitis. The corneas of C57BL/6 mice were pretreated with LOX-1 inhibitor Poly(I) or Dectin-1 siRNA separately before the infection of
Xia Hua et al.
PloS one, 10(6), e0128039-e0128039 (2015-06-04)
Fungal infections of the cornea can be sight-threatening and have a worse prognosis than other types of microbial corneal infections. Peptidoglycan recognition proteins (PGLYRP), which are expressed on the ocular surface, play an important role in the immune response against
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.