Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU096711

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGCAGCAAGAGATGATGAGGCAGCTGCAGTTGCACTTTCCTCCCTGATTCATGCTTTGGATGACTTAGACATGGTGGCCATAGTTCGATATGCTTATGACAAAAGAGCTAATCCTCAAGTCGGCGTGGCTTTTCCTCATATCAAGCATAACTATGAGTGTTTAGTGTATGTGCAGCTGCCTTTCATGGAAGACTTGCGGCAATACATGTTTTCATCCTTGAAAAACAGTAAGAAATATGCTCCCACCGAGGCACAGTTGAATGCTGTTGATGCTTTGATTGACTCCATGAGCTTGGCAAAG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Kai Wu et al.
The Journal of international medical research, 47(2), 893-904 (2019-01-09)
The aim of this study was to observe the effect of Ku86 on cellular senescence and apoptosis induced by various doses of ionizing radiation in human umbilical vein endothelial cells (HUVECs). Senescence-associated β-galactosidase activity was detected to evaluate cell senescence.
Damiano Fantini et al.
Molecular biology of the cell, 28(1), 192-200 (2016-12-31)
Damaged DNA-binding protein 2 (DDB2), a nuclear protein, participates in both nucleotide excision repair and mRNA transcription. The transcriptional regulatory function of DDB2 is significant in colon cancer, as it regulates metastasis. To characterize the mechanism by which DDB2 participates
Katerina Jerabkova et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12751-12767 (2020-08-02)
Equal segregation of chromosomes during mitosis ensures euploidy of daughter cells. Defects in this process may result in an imbalance in the chromosomal composition and cellular transformation. Proteolytic and non-proteolytic ubiquitylation pathways ensure directionality and fidelity of mitotic progression but
Kristen E Mengwasser et al.
Molecular cell, 73(5), 885-899 (2019-01-29)
BRCA1 or BRCA2 inactivation drives breast and ovarian cancer but also creates vulnerability to poly(ADP-ribose) polymerase (PARP) inhibitors. To search for additional targets whose inhibition is synthetically lethal in BRCA2-deficient backgrounds, we screened two pairs of BRCA2 isogenic cell lines
Prashant Rai et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(26), E3421-E3430 (2015-06-17)
Streptococcus pneumoniae is a leading cause of pneumonia and one of the most common causes of death globally. The impact of S. pneumoniae on host molecular processes that lead to detrimental pulmonary consequences is not fully understood. Here, we show

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.