Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU092501

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACATGGACCTGCGCTTCCAGGTCCTGGAGACCGCCAGCTACAATGGAGTGCTCATCTGGAAGATTCGCGACTACAAGCGGCGGAAGCAGGAGGCCGTCATGGGGAAGACCCTGTCCCTTTACAGCCAGCCTTTCTACACTGGTTACTTTGGCTATAAGATGTGTGCCAGGGTCTACCTGAACGGGGACGGGATGGGGAAGGGGACGCACTTGTCGCTGTTTTTTGTCATCATGCGTGGAGAATATGATGCCCTGCTTCCTTGGCCGTTTAAGCAGAAAGTGACACTCATGCTGATGGATCAGGGGTCCTCTCGACGTCATTTGGGAGATGCATTCAAGCCCGACCCCAACAGCAGCAGCTTCAAGAAGCCCACTGGAGAGATGAATATCGCCTCTGGCTGCCCAGTCTTTGTGGCCCAAACTGT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Liping Sun et al.
IUBMB life, 69(3), 170-178 (2017-02-12)
This study aims to investigate the effects of TNF receptors associated factor 3 (TRAF3) on the signaling pathway and expression of downstream products of nuclear factor kappa B (NF-κB) in the epithelial cells of renal ducts in individuals with polycystic
Peng Li et al.
Brain, behavior, and immunity, 79, 174-185 (2019-02-04)
Neuroinflammation occurs after germinal matrix hemorrhage (GMH) and induces secondary brain injury. Interferon-α (IFN-α) has been shown to exert anti-inflammatory effects in infectious diseases via activating IFNAR and its downstream signaling. We aimed to investigate the anti-inflammatory effects of Recombinant
Yan Zhou et al.
Cell death & disease, 12(1), 10-10 (2021-01-09)
Neuronal apoptosis has an important role in early brain injury (EBI) following subarachnoid hemorrhage (SAH). TRAF3 was reported as a promising therapeutic target for stroke management, which covered several neuronal apoptosis signaling cascades. Hence, the present study is aimed to
Hongzhi Sun et al.
International immunopharmacology, 88, 106691-106691 (2020-08-22)
Acute pancreatitis (AP) is an inflammatory disease with high morbidity and mortality. Dysregulation of microRNAs (miRNAs) was involved in human diseases, including AP. However, the effects of miR-92b-3p on AP process and its mechanism remain not been fully clarified. The
Jin Liu et al.
Scientific reports, 7, 40487-40487 (2017-01-11)
The role of osteoclastic miRNAs in regulating osteolytic bone metastasis (OBM) of breast cancer is still underexplored. Here, we examined the expression profiles of osteoclastogenic miRNAs in human bone specimens and identified that miR-214-3p was significantly upregulated in breast cancer

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.