Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU088931

Sigma-Aldrich

MISSION® esiRNA

targeting human MSN

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCACCTGGCTGAAACTCAATAAGAAGGTGACTGCCCAGGATGTGCGGAAGGAAAGCCCCCTGCTCTTTAAGTTCCGTGCCAAGTTCTACCCTGAGGATGTGTCCGAGGAATTGATTCAGGACATCACTCAGCGCCTGTTCTTTCTGCAAGTGAAAGAGGGCATTCTCAATGATGATATTTACTGCCCGCCTGAGACCGCTGTGCTGCTGGCCTCGTATGCTGTCCAGTCTAAGTATGGCGACTTCAATAAGGAAGTGCATAAGTCTGGCTACCTGGCCGGAGACAAGTTGCTCCCGCAGAGAGTCCTGGAACAGCACAAACTCAACAAGGACCAGTGGGAGGAGCGGATCCAGGTGTGGCATGAGGAACACCGTGGCATGCTCAGGGAGGATGCTGTCCT

N° accesso Ensembl | uomo

ENSG00000147065

N° accesso NCBI

NM_002444

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MSN(4478) , MSN(4478)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Classe di pericolosità dell'acqua (WGK)

WGK 1

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Bernard Degryse et al.
The international journal of biochemistry & cell biology, 88, 14-22 (2017-05-06)
The glycosyl-phosphatidyl-inositol (GPI)-anchored urokinase receptor (uPAR) has no intracellular domain, but nevertheless initiates signalling through proximal interactions with other membrane receptors including integrins. The relationships between uPAR and ezrin/radixin/moesin (ERM) proteins, moesin and merlin have never been explored. Moesin and
Shubing Lan et al.
Biochemical and biophysical research communications, 524(4), 861-868 (2020-02-15)
Moesin has been proved to be implicated in invasiveness and metastasis in many other cancers, but unclear in HCC. Thus, this study was performed to investigate the clinical significance of moesin and its biological functions in HCC. The results showed
Yutaro Hoshi et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 40(7), 1533-1545 (2019-08-15)
The purpose of this study was to clarify the roles of ERM proteins (ezrin/radixin/moesin) in the regulation of membrane localization and transport activity of transporters at the human blood-brain barrier (BBB). Ezrin or moesin knockdown in a human in vitro BBB
Yao-yin Li et al.
Oral oncology, 51(10), 935-943 (2015-07-22)
The present study aimed to clarify the role of Moesin in oral squamous cell carcinoma (OSCC) progression, especially in regulation of cell motility. Immunohistochemistry and western blotting were used to investigate the expression of Moesin, E-cadherin, p120-catenin and MT1-MMP in
Liza Botros et al.
Journal of cell science, 133(9) (2020-03-22)
Endothelial barrier dysfunction leads to edema and vascular leak, causing high morbidity and mortality. Previously, Abl kinase inhibition has been shown to protect against vascular leak. Using the distinct inhibitory profiles of clinically available Abl kinase inhibitors, we aimed to

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.