Transfection protocols vary from transfection reagent and cell line. Transfect the cell line of interest with esiRNA following the manufacturer’s instructions for the transfection reagent. esiRNA should be tested in a pilot experiment to validate the best concentration and experimental procedure to use with every cell line. Known transfection conditions used for chemically synthesized siRNA are a good starting point for optimization.
EHU087051
MISSION® esiRNA
targeting human MVP
Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Scegli un formato
20 μG
CHF 249.00
50 μG
CHF 443.00
CHF 249.00
Check Cart for Availability
Scegli un formato
Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00
About This Item
Codice UNSPSC:
41105324
NACRES:
NA.51
CHF 249.00
Check Cart for Availability
Prodotti consigliati
Descrizione
Powered by Eupheria Biotech
Nome Commerciale
MISSION®
Stato
lyophilized powder
Sequenza bersaglio del cDNA di esiRNA
AAGACCCGTGTGGTCAGCTACCGCGTGCCCCACAACGCTGCGGTGCAGGTGTACGACTACCGAGAGAAGCGAGCCCGCGTGGTCTTCGGGCCTGAGCTGGTGTCGCTGGGTCCTGAGGAGCAGTTCACAGTGTTGTCCCTCTCAGCTGGGCGGCCCAAGCGTCCCCATGCCCGCCGTGCGCTCTGCCTGCTGCTGGGGCCTGACTTCTTCACAGACGTCATCACCATCGAAACGGCGGATCATGCCAGGCTGCAACTGCAGCTGGCCTACAACTGGCACTTTGAGGTGAATGACCGGAAGGACCCCCAAGAGACGGCCAAGCTCTTTTCAGTGCCAGACTTTGTAGGTGATGCCTGCAAAGCCATCGCATCCCGGGTGCGGGGGGCCGTGGCCTCTGTCACTTTCGATGACTTCCATAAGAACTCAGCCCG
N° accesso Ensembl | uomo
N° accesso NCBI
Condizioni di spedizione
ambient
Temperatura di conservazione
−20°C
Categorie correlate
Descrizione generale
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Note legali
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Codice della classe di stoccaggio
10 - Combustible liquids
Punto d’infiammabilità (°F)
Not applicable
Punto d’infiammabilità (°C)
Not applicable
Scegli una delle versioni più recenti:
Certificati d'analisi (COA)
Lot/Batch Number
Non trovi la versione di tuo interesse?
Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.
Possiedi già questo prodotto?
I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.
Hyun Min Lee et al.
Scientific reports, 7(1), 13201-13201 (2017-10-19)
Circulating tumor cells (CTCs) play a major role in the metastasis and recurrence of hepatocellular carcinoma (HCC). Here, we found that major vault protein (MVP) is expressed on the surface of HCC cells and further induced under stressful environments. MVP
Shi Liu et al.
Journal of hepatology, 62(5), 1015-1023 (2014-12-08)
We previously demonstrated that major vault protein (MVP) is a novel virus-induced host factor and its expression upregulates type-I interferon production, leading to cellular antiviral response. However, it remains unclear whether the antiviral function of MVP is impaired during hepatitis
-
How long should I transfect cells with this product?
1 answer-
Helpful?
-
Active Filters
Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..
Contatta l'Assistenza Tecnica.
