Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU085201

Sigma-Aldrich

MISSION® esiRNA

targeting human NDRG1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGTCGAGGCTAGAGGCATTTGGAACAACAAATCTACGTAGTTAACTTGAAGAAACCGATTTTTAAAGTTGGTGCATCTAGAAAGCTTTGAATGCAGAAGCAAACAAGCTTGATTTTTCTAGCATCCTCTTAATGTGCAGCAAAAGCAGGCGACAAAATCTCCTGGCTTTACAGACAAAAATATTTCAGCAAACGTTGGGCATCATGGTTTTTGAAGGCTTTAGTTCTGCTTTCTGCCTCTCCTCCACAGCCCCAACCTCCCACCCCTGATACATGAGCCAGTGATTATTCTTGTTCAGGGAGAAGATCATTTAGATTTGTTTTGCATTCCTTAGAATGGAGGGCAACATTCCACAGCTGCCCTGGCTGTGATGAGTGTCCTTGCAGGGGCCGGAGTAGGAGCACTGGGGTGGGGGTGGAATTGGGGTTACTCGA

N° accesso Ensembl | uomo

ENSG00000104419

N° accesso NCBI

NM_006096

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... NDRG1(10397) , NDRG1(10397)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jinju Liu et al.
Human cell, 33(4), 1176-1185 (2020-08-07)
Numerous studies demonstrated that microRNAs (miRNAs) were highly involved in pancreatic cancer development. However, the functional roles of many miRNAs remain elusive in pancreatic cancer. In the present study, we analyzed previous published microarray data and found that miR-1469-5p was
Gang Cen et al.
Oncology reports, 37(2), 1189-1195 (2017-01-12)
The N-myc downstream regulated gene 1 (NDRG1) is differently expressed in human malignancies according to the tumor type. We investigated the expression of NDRG1 in pancreatic cancer tissues and cell lines as well as how it affects tumor growth, invasion and
Aiwei Li et al.
Scientific reports, 9(1), 5166-5166 (2019-03-28)
N-myc downstream regulated gene 1 (NDRG1) is an intracellular protein involved in cell differentiation and was recently reported to exert various effects in several cancers. However, its expression and role in bladder cancer remain unclear. Our study enrolled 100 bladder
Nan Meng et al.
Molecular reproduction and development, 86(9), 1210-1223 (2019-07-25)
Embryo implantation is an essential step for a successful pregnancy, and any defect in this process can lead to a range of pregnancy pathologies. The objective of this study was to explore the role of N-myc downregulated gene 1 (NDRG1)
Zhi-Yan Hu et al.
Biochimica et biophysica acta, 1852(9), 1876-1886 (2015-06-15)
N-myc downstream-regulated gene 1 (NDRG1) has been implicated in tumorigenesis and metastasis in different cancers. However, its role in nasopharyngeal carcinoma remains unknown. We found that NDRG1 expression level was high in nasopharyngeal cancer 5-8F cells but low in 5-8F-LN
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.