Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU084801

Sigma-Aldrich

MISSION® esiRNA

targeting human ETS1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51
Prezzi e disponibilità al momento non sono disponibili

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGAGACCTTCCAAGGACAGCCGTGTTGGTTGGACTCTGAATTTTGAATTGTTATTCTATTTTTTATTTTCCAGAACTCATTTTTTACCTTCAGGGGTGGGAGCTAAGTCAGTTGCAGCTGTAATCAATTGTGCGCAGTTGGGAAAGGAAAGCCAGGACTTGTGGGGTGGGTGGGACCAGAAATTCTTGAGCAAATTTTCAGGAGAGGGAGAAGGGCCTTCTCAGAAGCTTGAAGGCTCTGGCTTAACAGAGAAAGAGACTAATGTGTCCAATCATTTTTAAAAATCATCCATGAAAAAGTGTCTTGAGTTGTGGACCCATTAGCAAGTGACATTGTCACATCAGAACTCATGAAACTGATGTAAGGCAATTAATTTGCTTCTGTTTTTAGGTCTGGGAGGGC

N° accesso Ensembl | uomo

ENSG00000134954

N° accesso NCBI

NM_005238

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ETS1(2113) , ETS1(2113)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
EAV
LVU
NQU
QCS
QGT

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Manhui Zhu et al.
Cell and tissue research, 376(3), 341-351 (2019-03-06)
Choroidal neovascularization (CNV) is the basic feature of neovascular age-related macular degeneration (AMD), the leading cause of blindness in elders. Macrophages and microglia promote CNV via producing pro-angiogenic factors and inflammatory cytokines. Transcription factor E26 transformation specific-1 (Ets1) plays a
Haihong Liao et al.
Oncology reports, 40(4), 2389-2398 (2018-08-15)
An increasing number of studies have reported that microRNAs (miRNAs) are dysregulated in cervical cancer and serve critical roles in cervical oncogenesis and progression. Therefore, identifying the aberrantly expressed miRNAs implicated in the formation and progression of cervical cancer may
Huijie Gao et al.
Cancer letters, 354(2), 427-437 (2014-08-20)
We previously reported that β6 integrin played an important role in the progression of colon cancer. In this study, we demonstrated that β6 integrin induced the expression of MMP-3/MMP-9 and the invasion of colon cancer cells. Moreover, that function was
Li Liu et al.
Journal of experimental & clinical cancer research : CR, 35, 3-3 (2016-01-09)
The synthetic biology technology which enhances the specificity and efficacy of treatment is a novel try in biomedical therapy during recent years. A high frequency of somatic mutations was shown in the human telomerase reverse transcriptase (hTERT) promoter in bladder
Yutao Yang et al.
Molecular neurobiology, 54(6), 4421-4431 (2016-06-29)
Galanin receptor 2 (GAL2R) is a G protein-coupled receptor for the neuropeptide galanin that regulates many important physiological functions and pathological processes. To investigate the molecular mechanism governing GAL2R gene transcription, the rat GAL2R promoter was isolated and analyzed. We
Visualizza tutti i documenti correlati

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.