Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU083941

Sigma-Aldrich

MISSION® esiRNA

targeting human VEGFA

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCTCCGAAACCATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCATGGCAGAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATCCAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACATCTTCAAGCCATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAACAAATGTGAATGCA

N° accesso Ensembl | uomo

ENSG00000112715

N° accesso NCBI

NM_001025366

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... VEGFA(7422) , VEGF(7422)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jae Hyeop Lee et al.
Journal of controlled release : official journal of the Controlled Release Society, 263, 29-38 (2017-04-05)
RNA, one of the major biological macromolecules, has been considered as an attractive building material for bottom-up fabrication of nanostructures in the past few decades due to advancements in RNA biology, RNA chemistry and RNA nanotechnology. Most recently, an isothermal
Huan Sun et al.
Journal of cellular physiology, 234(11), 20623-20633 (2019-04-21)
Myocardial ischemia is accompanied with hypoxia injury in myocardial cells. Long noncoding RNAs (lncRNA) CAMK2D-associated transcript 1 (C2dat1) C2dat1) has been linked with several ischemic diseases. However, the investigation regarding its role in myocardial ischemia is relatively rare. The aim
Zhaohui Liu et al.
Molecular immunology, 106, 153-158 (2019-01-07)
MicroRNAs (miRNAs) play important roles in kidney development and maintenance of kidney physiological functions. MiR-377 has been reported to regulate inflammation in cardiac and cerebral ischemia. However, it remains unclear whether it has a similar function in renal ischemia/reperfusion (I/R).
So Yoon Ahn et al.
Experimental & molecular medicine, 50(4), 26-26 (2018-04-14)
We previously reported the role of vascular endothelial growth factor (VEGF) secreted by mesenchymal stem cells (MSCs) in protecting against neonatal hyperoxic lung injuries. Recently, the paracrine protective effect of MSCs was reported to be primarily mediated by extracellular vesicle
Yong-Chao Jiang et al.
Journal of biomedical materials research. Part A, 106(6), 1595-1603 (2018-02-11)
During the process of tissue regeneration facilitated by stem cells, physical properties of a scaffold affect behavior and activities of the cell. To enhance differentiation of human mesenchymal stem cells (MSCs) into endothelial-like cells (ELCs), we used electrospun fibrous substrates
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.