Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU078741

Sigma-Aldrich

MISSION® esiRNA

targeting human GAB2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCTCCCAAACAATGACTTCCTGCCATGTTTGATGGGGACAGCTACCACTGTCCTCTGCCCCCATTCCCCTTTCAGCTCCCATGAGCATGCATAGTTCACCAGACCAATGGCCTAGCCATTCTCTAAGTCCCATCCTGGAAGAAGTTATTTCTTCAAGAGCTGCACCTCTCCTCCTAGCATTAGTTTAGATCAACTCAAGGAGTATTTATTAATGGCTGCTGTCTCCAGTTTCTGGGGTTAAGCACTAAGGACACAAGAATCAATCAGACCTTCTCCCTGAACTTAAGATAGCCACAATCAGAAAAAGGACAAGGACATGAGACAGTGGTGATGGCCATCAGACAGAGACTTCAAATGCTGATGGAGGGCAGAGGAAGTACTTAGGGAGGTTGGTGTCAGAGGCAG

N° accesso Ensembl | uomo

ENSG00000033327

N° accesso NCBI

NM_012296

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... GAB2(9846) , GAB2(9846)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
QCS
WNS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Peng Zhang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(1), 52-65 (2018-10-17)
HER2 has been implicated in mammary tumorigenesis as well as aggressive tumor growth and metastasis. Its overexpression is related to a poor prognosis and chemoresistance in breast cancer patients. Although Grb2-associated binding protein 2 (Gab2) is important in the development
Xiang-Rui Qiao et al.
Oncology letters, 20(4), 99-99 (2020-08-25)
The development of prostate cancer is complicated and involves a number of tumor-associated gene expression level abnormalities. Gene chip technology is a high-throughput method that can detect gene expression levels in different tissues and cells on a large scale. In
Jiuhong Ma et al.
Oncology reports, 37(2), 1159-1167 (2016-12-22)
Glioma is the most frequent and aggressive primary tumor of the brain in humans. Over the last few decades, significant progress has been made in early detection and multi-mode treatments, but the prognosis of gliomas is still extremely poor. MicroRNAs
Wen Jie Wang et al.
International journal of clinical and experimental pathology, 8(9), 10575-10584 (2015-12-01)
Non-small cell lung cancer (NSCLC) is a leading cause of cancer-related death and often has a poor prognosis. Investigation of NSCLC cancer cell migration, invasion and development of strategies to block this process is essential to improve the disease prognosis.
Yiping Huang et al.
Biochemical and biophysical research communications, 503(3), 2028-2032 (2018-08-11)
The functionality of lncRNA snaR has only been characterized in breast cancer and colon cancer. The aim of the current study is to explore the involvement of lncRNA snaR in ovarian carcinoma (OC). Expression of lncRNA snaR and GRB2-associated binding
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.