Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU077841

Sigma-Aldrich

MISSION® esiRNA

targeting human LARP1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCTACCGAAAGTTTGATGGTGTGGAGGGGCCTCGTACGCCCAAGTACATGAACAACATCACCTACTACTTTGACAATGTCAGCAGCACCGAGCTTTACAGTGTGGATCAGGAACTGCTCAAAGACTACATCAAGCGCCAGATTGAATACTACTTCAGCGTGGACAATTTAGAGCGAGACTTCTTCCTGCGAAGGAAAATGGATGCTGATGGTTTCCTACCCATCACCCTTATTGCTTCCTTCCACCGAGTGCAGGCCCTTACCACTGACATTTCACTCATCTTTGCGGCCCTAAAGGACAGCAAGGTGGTGGAGATCGTTGATGAGAAAGTTCGTAGGAGGGAGGAACCAGAAAAGTGGCCTCTTCCCCCAATAGTGGATTATTCACAGACTGATTTCTCCCAGC

N° accesso Ensembl | uomo

ENSG00000155506

N° accesso NCBI

NM_015315

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... LARP1(23367) , LARP1(23367)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Marie-Laure Plissonnier et al.
Virus research, 271, 197679-197679 (2019-08-10)
Hepatitis C virus (HCV) virions contain a subset of host liver cells proteome often composed of interesting virus-interacting factors. A proteomic analysis performed on double gradient-purified clinical HCV highlighted the translation regulator LARP1 on these virions. This finding was validated
Johannes H Wilbertz et al.
Molecular cell, 73(5), 946-958 (2019-01-22)
Biological phase transitions form membrane-less organelles that generate distinct cellular environments. How molecules are partitioned between these compartments and the surrounding cellular space and the functional consequence of this localization is not well understood. Here, we report the localization of
Ewan M Smith et al.
Nucleic acids research, 49(1), 458-478 (2020-12-18)
The mammalian target of rapamycin (mTOR) is a critical regulator of cell growth, integrating multiple signalling cues and pathways. Key among the downstream activities of mTOR is the control of the protein synthesis machinery. This is achieved, in part, via
Maria Dermit et al.
Developmental cell, 55(3), 298-313 (2020-11-11)
Translation of ribosomal protein-coding mRNAs (RP-mRNAs) constitutes a key step in ribosome biogenesis, but the mechanisms that modulate RP-mRNA translation in coordination with other cellular processes are poorly defined. Here, we show that subcellular localization of RP-mRNAs acts as a

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.