Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU077521

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2C

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCTCATGATGTCTGGCGATAAAGGGATTTCTGCCTTCCCTGAATCAGACAACCTTTTCAAATGGGTAGGGACCATCCATGGAGCAGCTGGAACAGTATATGAAGACCTGAGGTATAAGCTCTCGCTAGAGTTCCCCAGTGGCTACCCTTACAATGCGCCCACAGTGAAGTTCCTCACGCCCTGCTATCACCCCAACGTGGACACCCAGGGTAACATATGCCTGGACATCCTGAAGGAAAAGTGGTCTGCCCTGTATGATGTCAGGACCATTCTGCTCTCCATCCAGAGCCTTCTAGGAGAACCCAACATTGATAGTCCCTTGAACACACATGCTGCCGAGCTCTGGAAAAACCCCACAGCTTTTAAGAAGTACCTGCAAGAAACCTACTCAAAGCAGGTCACCAGC

N° accesso Ensembl | uomo

ENSG00000175063

N° accesso NCBI

NM_181801

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... UBE2C(11065) , UBE2C(11065)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Pei-Feng Liu et al.
Diagnostics (Basel, Switzerland), 10(9) (2020-09-10)
Ubiquitin-conjugating enzyme 2C (UBE2C) involves in numerous cellular processes and the tumor progression in many cancers. However, its role in oral squamous cell carcinoma (OSCC) is unclear. We aimed to investigate the role and clinical significance of UBE2C in OSCC.
Liang Guo et al.
Cell cycle (Georgetown, Tex.), 16(18), 1705-1718 (2017-08-03)
Ubiquitin-conjugating enzyme E2C (UBE2C) is characterized as a crucial molecule in cancer cell growth that plays an essential role in the development of gliomas, but the detailed mechanisms have not been fully elucidated. In this study, we found that Forkhead
Ying Wang et al.
Biochemical and biophysical research communications, 534, 597-603 (2020-11-24)
Ubiquitin Conjugating Enzyme E2 C (UBE2C) has a key oncogenic role in many human malignancies, including gastric cancer. However, it remains largely unknow at which level UBE2C expression is altered, as well as what are the downstream targets of UBE2C.
Xianxing Wang et al.
The FEBS journal, 286(24), 4889-4909 (2019-11-13)
Ubiquitin-conjugating enzyme 2C (UBE2C) is a core ubiquitin-conjugating enzyme in the ubiquitin-proteasome system that promotes cell cycle progression. Previous studies have indicated that UBE2C mediates tumorigenesis and progression in various cancers, but its role in pancreatic ductal adenocarcinoma (PDAC) remains
Rui Wang et al.
International journal of oncology, 50(4), 1116-1126 (2017-03-06)
The ubiquitin-conjugating enzyme 2C (UBE2C) is the key component in the ubiquitin proteasome system (UPS) by partnering with the anaphase‑promoting complex (APC/C). A high UBE2C protein expression level has been reported in various types of human tumors. However, little is known about the precise mechanism
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.