Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU075951

Sigma-Aldrich

MISSION® esiRNA

targeting human FBXW7

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAGCAGTCACAGGCAAATGTCTGAGAACATTAGTGGGACATACAGGTGGAGTATGGTCATCACAAATGAGAGACAACATCATCATTAGTGGATCTACAGATCGGACACTCAAAGTGTGGAATGCAGAGACTGGAGAATGTATACACACCTTATATGGGCATACTTCCACTGTGCGTTGTATGCATCTTCATGAAAAAAGAGTTGTTAGCGGTTCTCGAGATGCCACTCTTAGGGTTTGGGATATTGAGACAGGCCAGTGTTTACATGTTTTGATGGGTCATGTTGCAGCAGTCCGCTGTGTTCAATATGATGGCAGGAGGGTTGTTAGTGGAGCATATGATTTTATGGTAAAGGTGTGGGATCCAGAGACTGAAACCTGTCTACACACGTTGCAGGGGCATACTAAT

N° accesso Ensembl | uomo

ENSG00000109670

N° accesso NCBI

NM_033632

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FBXW7(55294) , FBXW7(55294)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jun Shao et al.
Molecular and cellular endocrinology, 498, 110541-110541 (2019-08-16)
MicroRNAs (miRNAs) are small RNAs without protein-coding functions that negatively regulate target genes and play important roles in physiological and pathological processes. The aim of this work was to reveal a novel miRNA/gene pathway in diabetic retinopathy (DR). A microarray
Mariusz L Hartman et al.
Molecular carcinogenesis, 58(4), 588-602 (2018-12-18)
We have extensively studied the phenotypic heterogeneity of patient-derived melanoma cells. Here, whole-exome sequencing revealed novel variants of genes associated with the MAPK, NOTCH, Hippo, cell-cycle, senescence, and ubiquitin-dependent pathways, which could contribute to the observed phenotypic diversity between cell
Hui Wang et al.
Cancer cell international, 20, 258-258 (2020-06-25)
Cisplatin is widely used as a first-line treatment for non-small cell lung cancer (NSCLC), but chemoresistance remains a major clinical obstacle for efficient use. As a microRNA, miR-223 was reported to promote the doxorubicin resistance of NSCLC. However, whether miR-223
Qiang Fu et al.
Aging, 11(24), 11865-11879 (2019-12-28)
Our study aspires to understand the impact of miR-27b on myocardial fibrosis as well as its functional mechanism. 12 days post the ligation of coronary artery in rats, the expression of miR-27b in the peri-infarction region was elevated. Treating cultivated
Veronika Reiterer et al.
The EMBO journal, 36(3), 260-273 (2016-12-23)
The F-box protein FBXW7 is the substrate-recruiting subunit of an SCF ubiquitin ligase and a major tumor-suppressor protein that is altered in several human malignancies. Loss of function of FBXW7 results in the stabilization of numerous proteins that orchestrate cell
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.