Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU075731

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXO4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAAGCTCTTGGTGGATGCTGAACCCTGAGGGAGGCAAGAGCGGCAAAGCCCCCCGCCGCCGGGCCGCCTCCATGGATAGCAGCAGCAAGCTGCTCCGGGGCCGCAGTAAAGCCCCCAAGAAGAAACCATCTGTGCTGCCAGCTCCACCCGAAGGTGCCACTCCAACGAGCCCTGTCGGCCACTTTGCCAAGTGGTCAGGCAGCCCTTGCTCTCGAAACCGTGAAGAAGCCGATATGTGGACCACCTTCCGTCCACGAAGCAGTTCAAATGCCAGCAGTGTCAGCACCCGGCTGTCCCCCTTGAGGCCAGAGTCTGAGGTGCTGGCGGAGGAAATACCAGCTTCAGTCAGCAGTTATGCAGGGGGTGTCCCTCCCACCCTCAATGAAGGTCTAGAGCTGTTAGATGGGCTCAATCTCACCTCTTCCCATTCCCTGCTATCTCGGAG

N° accesso Ensembl | uomo

ENSG00000184481

N° accesso NCBI

NM_005938

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FOXO4(4303) , FOXO4(4303)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Nikolaos Doumpas et al.
The EMBO journal, 38(2) (2018-11-15)
During canonical Wnt signalling, the activity of nuclear β-catenin is largely mediated by the TCF/LEF family of transcription factors. To challenge this view, we used the CRISPR/Cas9 genome editing approach to generate HEK 293T cell clones lacking all four TCF/LEF
Linna Su et al.
BMC cancer, 14, 378-378 (2014-06-03)
FOXO4, a member of the FOXO family of transcription factors, is currently the focus of intense study. Its role and function in gastric cancer have not been fully elucidated. The present study was aimed to investigate the expression profile of
Yanying Liu et al.
Human molecular genetics, 26(22), 4416-4428 (2017-10-04)
Although it has been speculated that proteasome dysfunction may contribute to the pathogenesis of Huntington's disease (HD), a devastating neurodegenerative disorder, how proteasome activity is regulated in HD affected stem cells and somatic cells remains largely unclear. To better understand
Jianbin Zhang et al.
Autophagy, 11(4), 629-642 (2015-04-29)
Autophagy is a catabolic process in response to starvation or other stress conditions to sustain cellular homeostasis. At present, histone deacetylase inhibitors (HDACIs) are known to induce autophagy in cells through inhibition of mechanistic target of rapamycin (MTOR) pathway. FOXO1

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.