Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU075291

Sigma-Aldrich

MISSION® esiRNA

targeting human VPS35

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGTGAAGATGGACCTGGAATCCCAGCGGATATTAAACTTTTTGATATATTTTCACAGCAGGTGGCTACAGTGATACAGTCTAGACAAGACATGCCTTCAGAGGATGTTGTATCTTTACAAGTCTCTCTGATTAATCTTGCCATGAAATGTTACCCTGATCGTGTGGACTATGTTGATAAAGTTCTAGAAACAACAGTGGAGATATTCAATAAGCTCAACCTTGAACATATTGCTACCAGTAGTGCAGTTTCAAAGGAACTCACCAGACTTTTGAAAATACCAGTTGACACTTACAACAATATTTTAACAGTCTTGAAATTAAAACATTTTCACCCACTCTTTGAGTACTTTGACTACGAGTCCAGAAAGAGCATGAGTTGTTATGTGCTTAGTAATGTTCTGGATTATAACACAGAAATTGTCTCTCAAGACCAGGTGGATTCCAT

N° accesso Ensembl | uomo

ENSG00000069329

N° accesso NCBI

NM_018206

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... VPS35(55737) , VPS35(55737)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
GWT
HUT
OOT
XJT
EGS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Peiqi Yin et al.
Cellular and molecular life sciences : CMLS, 73(4), 869-881 (2015-08-25)
Hepatitis C virus (HCV) has infected over 170 million people worldwide. Phosphatidylinositol 4-phosphate (PI4P) is the organelle-specific phosphoinositide enriched at sites of HCV replication. Whether retromer, a PI4P-related host transport machinery, unloads its cargo at HCV replication sites remains inconclusive.
Amod Godbole et al.
Nature communications, 8(1), 443-443 (2017-09-07)
A new paradigm of G-protein-coupled receptor (GPCR) signaling at intracellular sites has recently emerged, but the underlying mechanisms and functional consequences are insufficiently understood. Here, we show that upon internalization in thyroid cells, endogenous TSH receptors traffic retrogradely to the
Anna Ansell-Schultz et al.
Molecular and cellular neurosciences, 93, 18-26 (2018-09-27)
Alzheimer's disease (AD) is a neurodegenerative disorder characterized by a progressive loss of multiple cognitive functions. Accumulation of amyloid beta oligomers (oAβ) play a major role in the neurotoxicity associated with the disease process. One of the early affected brain
Santanu Das et al.
Journal of cell science, 133(24) (2020-12-04)
The Wilson disease protein, ATP7B maintains copper (herein referring to the Cu+ ion) homeostasis in the liver. ATP7B traffics from trans-Golgi network to endolysosomes to export excess copper. Regulation of ATP7B trafficking to and from endolysosomes is not well understood.
Prasad Tammineni et al.
Human molecular genetics, 26(22), 4352-4366 (2017-10-04)
Lysosomal proteolysis is essential for the quality control of intracellular components and the maintenance of cellular homeostasis. Lysosomal alterations have been implicated as one of the main cellular defects contributing to the onset and progression of Alzheimer's disease (AD). However
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.