Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU074341

Sigma-Aldrich

MISSION® esiRNA

targeting human OXA1L

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AATGTGGGCTGTTCTTGAGCTAGGTGCTGAGACAGGTGTGCAAAGTTCTGACCTTCAGTGGATGAGAAATGTCATCAGAATGATGCCCCTGATAACCTTGCCCATAACCATGCATTTCCCCACGGCAGTGTTTATGTACTGGCTCTCCTCCAATTTGTTTTCCCTGGTCCAAGTATCCTGTCTCCGGATTCCAGCAGTACGCACTGTACTTAAAATCCCCCAGCGTGTTGTACATGACCTGGACAAATTACCTCCACGGGAAGGCTTCCTAGAGAGCTTCAAAAAAGGCTGGAAAAATGCTGAAATGACGCGTCAGCTGCGAGAGCGTGAACAACGCATGCGGAATCAGTTGGAGCTAGCAGCCAGGGGTCCTTTACGACAGACCTTTACCCACAACCCTCTCCTACAACCTGGAAAGGATAACCCTCCCAATATCCCTAGCAGCAGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hongfei Chen et al.
Bioengineered, 11(1), 1269-1279 (2020-11-04)
Emerging evidence suggested that circular RNAs (circRNAs) play critical roles in cervical cancer (CC) progression. However, the roles and molecular mechanisms of hsa_circ_0007364 in the tumorigenesis of CC remain unclear. In the present study, we used bioinformatics analysis and a
F-J Huang et al.
European review for medical and pharmacological sciences, 24(4), 1887-1898 (2020-03-07)
Breast cancer (BC) is the second most frequent malignancy worldwide. Hsa_circ_0008039 exerts the carcinogenic factors in BC. However, the pathogenesis of hsa_circ_0008039 involved in BC is still unclear. The expression levels of hsa_circ_0008039, microRNA-515-5p (miR-515-5p) and chromobox homolog 4 (CBX4)
Hui Wang et al.
Frontiers in cell and developmental biology, 8, 278-278 (2020-06-09)
Fetal growth restriction (FGR) is a worldwide problem, and a major cause of perinatal morbidity. The precise molecular mechanisms involved in placental development and function during FGR remain poorly understood. Circular RNAs (circRNAs) are important biological molecules associated with disease
Yuhan Chen et al.
Gene, 629, 35-42 (2017-08-05)
Radiation-induced liver fibrosis (RILF) is considered as a major complication of radiation therapy for liver cancer. Circular RNA (circRNA) has been recently identified as a functional noncoding RNA involving in various biological processes. However, the expression pattern and regulatory capacity
Beibei Shao et al.
Biochemical and biophysical research communications, 513(1), 135-140 (2019-04-05)
Recent studies indicated that circular RNAs (circRNAs) could play critical roles in the initiation and development of tumors, including tongue squamous cell carcinoma (TSCC). We aimed to investigate the roles and underlying mechanisms of hsa_circ_0001742 in TSCC. In the present

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.