Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU073721

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCAGGACAAGTGGGACAGATTCGTCAAGCGCATCTTCTACTTCAACTTCCTGGTCTACTGCCTGTACATGATCATCTTCACCATGGCTGCCTACTACAGGCCCGTGGATGGCTTGCCTCCCTTTAAGATGGAAAAAACTGGAGACTATTTCCGAGTTACTGGAGAGATCCTGTCTGTGTTAGGAGGAGTCTACTTCTTTTTCCGAGGGATTCAGTATTTCCTGCAGAGGCGGCCGTCGATGAAGACCCTGTTTGTGGACAGCTACAGTGAGATGCTTTTCTTTCTGCAGTCACTGTTCATGCTGGCCACCGTGGTGCTGTACTTCAGCCACCTCAAGGAGTATGTGGCTTCCATGGTATTCTCCCTGGCCTTGGGCTGGACCAACATGCTCTACTACACCCGCGGTTTC

N° accesso Ensembl | uomo

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Gwan Hee Han et al.
Cancer genomics & proteomics, 17(3), 309-319 (2020-04-30)
Transient receptor potential vanilloid type 1 (TRPV1) has been studied in human malignancies, but has not been studied in epithelial ovarian cancer (EOC). We, therefore, investigated the significance of TRPV1 and correlation with phosphatase and tension homolog (PTEN) in EOC.
Ayumi Maeda et al.
Molecular nutrition & food research, 62(11), e1800086-e1800086 (2018-04-24)
The prevalence of type 2 diabetes mellitus (T2DM) is increasing yearly worldwide. Glycemic control is the basis for the treatment of T2DM, as it can prevent the progress of associated complications. Spices possess various health beneficial effects on humans. The
Mingming Ren et al.
Cardiovascular therapeutics, 34(6), 482-488 (2016-09-24)
Accumulating evidence showed that transient receptor potential channels play an important role in the regulation of cardiomyocyte differentiation. The vanilloid receptor 1 (VR1) is a member of the transient receptor channel super family and is expressed in cardiomyocytes. However, its
Masayoshi Kawase et al.
Scientific reports, 10(1), 9687-9687 (2020-06-18)
Despite successful clinical application of non-equilibrium atmospheric pressure plasma (APP), the details of the molecular mechanisms underlying APP-inducible biological responses remain ill-defined. We previously reported that exposure of 3T3L1 cells to APP-irradiated buffer raised the cytoplasmic free Ca2+ ([Ca2+]i) concentration
Shuo Wang et al.
Channels (Austin, Tex.), 14(1), 59-68 (2020-02-23)
The natural outcome of abdominal aortic aneurysm (AAA) is that of slow progression and ultimate rupture, then a life-threatening hemorrhage consequently. Ruptured AAA is a dramatic catastrophe and constitutes one of the leading causes of acute death in elderly men.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.