Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU067151

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP13

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGTCCAGGAGATGAAGACCCCAACCCTAAACATCCAAAAACGCCAGACAAATGTGACCCTTCCTTATCCCTTGATGCCATTACCAGTCTCCGAGGAGAAACAATGATCTTTAAAGACAGATTCTTCTGGCGCCTGCATCCTCAGCAGGTTGATGCGGAGCTGTTTTTAACGAAATCATTTTGGCCAGAACTTCCCAACCGTATTGATGCTGCATATGAGCACCCTTCTCATGACCTCATCTTCATCTTCAGAGGTAGAAAATTTTGGGCTCTTAATGGTTATGACATTCTGGAAGGTTATCCCAAAAAAATATCTGAACTGGGTCTTCCAAAAGAAGTTAAGAAGATAAGTGCAGCTGTTCACTTTGAGGATACAGGCAAGACTCTCCTGTTCTCAGGAAACCAGGTCTGGAG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Nobuaki Ozeki et al.
International journal of molecular sciences, 17(2), 221-221 (2016-02-11)
We established a differentiation method for homogeneous α7 integrin-positive human skeletal muscle stem cell (α7⁺hSMSC)-derived osteoblast-like (α7⁺hSMSC-OB) cells, and found that interleukin (IL)-1β induces matrix metalloproteinase (MMP)-13-regulated proliferation of these cells. These data suggest that MMP-13 plays a potentially unique
Xiao-Dong Li et al.
Chinese medical journal, 130(6), 717-721 (2017-03-18)
Dendritic cells are professional antigen-presenting cells found in an immature state in epithelia and interstitial space, where they capture antigens such as pathogens or damaged tissue. Matrix metallopeptidase 13 (MMP-13), a member of the collagenase subfamily, is involved in many
Rui Min Li et al.
American journal of cancer research, 8(6), 964-980 (2018-07-24)
The highly refractory nature of cervical cancer to chemotherapeutic drugs and its epithelial-to-mesenchymal transition (EMT) are the key reasons contributing to the poor prognosis of this disease. Golgi Membrane Protein 1 (GOLM1), a protein involved in the trafficking of proteins
Chia-Li M Shih et al.
Molecular biology reports, 42(7), 1225-1232 (2015-02-16)
Adipose tissue remodeling by the matrix metalloproteases (MMPs) is critical for tissue hypertrophy and obesity. MMP-13 is an important protein that is highly expressed in adipose tissue but whose potential role in adipose tissue expansion is poorly characterized. We investigated

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.