Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU064361

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTCCTCATGATCACAGCCTCTACATATGCAATAAGAGTTTCTAACTATGATATCTTCTGGTATACTCATAACCTCTTCTTTGTCTTCTACATGCTGCTGACGTTGCATGTTTCAGGAGGGCTGCTGAAGTATCAAACTAATTTAGATACCCACCCTCCCGGCTGCATCAGTCTTAACCGAACCAGCTCTCAGAATATTTCCTTACCAGAGTATTTCTCAGAACATTTTCATGAACCTTTCCCTGAAGGATTTTCAAAACCGGCAGAGTTTACCCAGCACAAATTTGTGAAGATTTGTATGGAAGAGCCCAGATTCCAAGCTAATTTTCCACAGACTTGGCTTTGGATTTCTGGACCTTTGTGCCTGTACTGTGCCGAAAGACTTTACAGGTATATCCGGAGCAATAAGCCAGTCACCATCATTTCGGTCATGAGTCATCCCTCAGATGTCATGGAAATCCGAATGGTCAA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wenwen Zhao et al.
Scientific reports, 7(1), 12953-12953 (2017-10-13)
ICAM-1 overexpression and subsequent adhesion of leukocytes to endothelial cells play critical roles in the early stage of atherosclerosis. Danshenol A (DA) is an abietane-type diterpenoid isolated from traditional Chinese herb Salvia miltiorrhiza Bunge. The mechanisms under its regulation of
Weichao Guo et al.
American journal of physiology. Lung cellular and molecular physiology, 312(6), L936-L944 (2017-03-25)
Myofibroblasts are important mediators of fibrogenesis; thus blocking fibroblast-to-myofibroblast differentiation (FMD) may be an effective strategy to treat pulmonary fibrosis (PF). Previously, we reported that histone deacetylase 4 (HDAC4) activity is necessary for transforming growth factor-β
Qian Sun et al.
Biochimica et biophysica acta, 1861(1 Pt A), 2912-2921 (2016-10-23)
Oxidative stress plays a crucial role in the development of alcoholic liver disease (ALD), however effective pharmacological treatment for oxidative injury is still lacking. The objective of this study was to determine whether inhibition of NADPH oxidase activity could reverse
Ha-Reum Lee et al.
Arthritis research & therapy, 22(1), 116-116 (2020-05-18)
Reactive oxygen species (ROS) regulate the migration and invasion of fibroblast-like synoviocytes (FLS), which are key effector cells in rheumatoid arthritis (RA) pathogenesis. Nicotinamide adenine dinucleotide phosphate oxidase 4 (NOX4) induces ROS generation and, consequently, enhances cell migration. Despite the
Yongpan Huang et al.
Oxidative medicine and cellular longevity, 2020, 3912173-3912173 (2020-12-05)
Oxymatrine (OMT) is the major quinolizidine alkaloid extracted from the root of Sophora flavescens Ait and has been shown to exhibit a diverse range of pharmacological properties. The aim of the present study was to investigate the role of OMT

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.